Antibodies Directed Against ICOS and Uses Thereof
US-2016264666-A1 · Sep 15, 2016 · US
Antibodies directed against ICOS for treating graft-versus-host disease
US9695247B2 · US · B2
| Field | Value |
|---|---|
| Publication number | US-9695247-B2 |
| Application number | US-201314424092-A |
| Country | US |
| Kind code | B2 |
| Filing date | Sep 3, 2013 |
| Priority date | Sep 3, 2012 |
| Publication date | Jul 4, 2017 |
| Grant date | Jul 4, 2017 |
How to read this patent
A practical reading order for non-experts. Skip the full description unless you need deep technical detail.
- Title
What the patent document calls the invention.
- Abstract
A short plain-language summary of the technical disclosure.
- Assignees and inventors
Who owns or filed the patent and who is credited as inventor.
- Key dates
Filing, priority, publication, and grant dates set the timeline.
- First independent claim
The legal scope of protection — read this for what is actually claimed.
- CPC / IPC classifications
Technology tags used to group this patent with similar filings.
- Citations and related patents
Prior art links and similar publications in this corpus.
Abstract
Official abstract text for this publication.
The invention relates to a specific antibody directed against, for use for treating graft versus host disease.
First claim
Opening claim text (preview).
The invention claimed is: 1. A method for treating a graft versus host disease in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of an antibody directed against ICOS having the following 6 CDRs: Aminoacid sequence H-CDR1 GYTFTTYWMH (SEQ ID NO: 7) H-CDR2 EIDPSDSYVNYNQNFKG (SEQ ID NO: 8) H-CDR3 FDY (SEQ ID NO: 9) L-CDR1 RSSKSPLHSNGNIYLY (SEQ ID NO: 10) L-CDR2 RMSNLAS (SEQ ID NO: 11) L-CDR3 MQHLEYPYT (SEQ ID NO: 12). 2. The method according to claim 1 , wherein the nucleotidic sequences encoding the 6 CDRs of said antibody are the following: DNA sequence H-CDR1 GGCTACACCTTCACCACCTACTGGATGCAC (SEQ ID NO: 1) H-CDR2 GAGATTGATCCTTCTGATAGTTATGTTAAC TACAATCAAAACTTTAAGGGC (SEQ ID NO: 2) H-CDR3 TTTGATTAC (SEQ ID NO: 3) L-CDR1 AGGTCTAGTAAGAGTCCCCTGCATAGTAAC GGCAACATTTACTTATAT (SEQ ID NO: 4) L-CDR2 CGGATGTCCAACCTTGCCTCA (SEQ ID NO: 5) L-CDR3 ATGCAACATCTAGAATATCCGTACACG (SEQ ID NO: 6). 3. The method according to claim 1 wherein said antibody comprises a heavy chain comprising SEQ ID NO:18 and a light chain comprising SEQ ID NO:20. 4. The method according to, claim 1 , wherein said antibody is encoded by at least the nucleotidic sequence SEQ ID NO:17 for the heavy chain and at least the nucleotidic sequence SEQ ID NO:19 for the light chain. 5. The method according to claim 1 , wherein said antibody is selected from the group consisting of Icos 314-8, conservative fragments of Icos 314-8 and conservative derivatives of Icos 314-8. 6. The method of claim 1 , wherein the graft versus host disease is selected from the group consisting of acute fulminant graft-versus-host-disease (aGVHD) and chronic graft-versus-host-disease (cGVHD).
Assignees
Inventors
Classifications
- C07K16/2896Primary
against molecules with a "CD"-designation, not provided for elsewhere · CPC title
Complementarity determining region [CDR] · CPC title
Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation · CPC title
comprising antibodies · CPC title
- C07K16/2818Primary
against CD28 or CD152 · CPC title
Patent family
Related publications grouped by family.
External sources
Frequently asked questions
Answers are generated from the same data shown on this page.
- What does patent US9695247B2 cover?
- The invention relates to a specific antibody directed against, for use for treating graft versus host disease.
- Who is the assignee on this patent?
- Inserm (Institut Nat De La Sante Et De La Rech Medicale), Centre Leon Berard, Université D'Aix-Marseille
- What technology area does this patent fall under?
- Primary CPC classification C07K16/2896. Mapped technology areas include Chemistry & Metallurgy.
- When was this patent published?
- Publication date Tue Jul 04 2017 00:00:00 GMT+0000 (Coordinated Universal Time) (B2). Legal status and post-grant events are not shown on this page.
- What related patents are in patentsdb?
- We list 2 related publications on this page (citations in our corpus or others sharing the same primary CPC).