Antibodies directed against ICOS and uses thereof
US-9376493-B2 · Jun 28, 2016 · US
US2016264666A1 · US · A1
| Field | Value |
|---|---|
| Publication number | US-2016264666-A1 |
| Application number | US-201615165152-A |
| Country | US |
| Kind code | A1 |
| Filing date | May 26, 2016 |
| Priority date | Mar 31, 2011 |
| Publication date | Sep 15, 2016 |
| Grant date | — |
A practical reading order for non-experts. Skip the full description unless you need deep technical detail.
What the patent document calls the invention.
A short plain-language summary of the technical disclosure.
Who owns or filed the patent and who is credited as inventor.
Filing, priority, publication, and grant dates set the timeline.
The legal scope of protection — read this for what is actually claimed.
Technology tags used to group this patent with similar filings.
Prior art links and similar publications in this corpus.
Official abstract text for this publication.
The present invention provides antibodies directed against ICOS or a derivative thereof which neutralize ICOS engagement on Treg by inhibiting the fixation between ICOS and ICOS-L and abrogate proliferation of Treg induced by plasmacytoid dendritic cells. The present invention further provides antibodies directed against ICOS or a derivative thereof which induce IL-10 and IFNγ production, induce CD4+ T cells proliferation, reduce Tconv proliferation, and increase the immunosuppressive function of Treg.
Opening claim text (preview).
1 - 22 . (canceled) 23 . An antibody directed against ICOS, wherein said antibody has the following 6 CDRs: Amino acid sequence H-CDR1 GYSFTSYWIN (SEQ ID NO: 23) H-CDR2 NIYPSDSYTNYNQMFKD (SEQ ID NO: 24) H-CDR3 WNLSYYFDNNYYLDY (SEQ ID NO: 25) L-CDR1 RSSKSLLHSNGNTYLY (SEQ ID NO: 26) L-CDR2 RMSNLAS (SEQ ID NO: 27) L-CDR3 MQHLEYPWT (SEQ ID NO: 28) 24 . An antibody according to claim 23 , wherein the nucleotidic sequences encoding the 6 CDRs are the following: DNA sequence H-CDR1 GGCTACAGTTTCACCAGCTACTGGATAAAC (SEQ ID NO: 17) H-CDR2 AATATTTATCCTTCTGATAGTTATACTAAC TACAATCAAATGTTCAAGGAC (SEQ ID NO: 18) H-CDR3 TGGAATCTTTCTTATTACTTCGATAATAAC TACTACTTGGACTAC (SEQ ID NO: 19) L-CDR1 AGGTCTAGTAAGAGTCTCCTGCATAGTAAT GGCAACACTTACTTGTAT (SEQ ID NO: 20) L-CDR2 CGGATGTCCAACCTTGCCTCA (SEQ ID NO: 21) L-CDR3 ATGCAACATCTAGAATATCCGTGGACG (SEQ ID NO: 22) 25 . An antibody according to claim 23 or a derivative thereof which: induces IL-10 and IFNγ production; induces CD4+ T cells proliferation; reduces Tconv proliferation, and increases the immunosuppressive function of Treg. 26 . A method of treatment of a patient in need thereof comprising the step of administering to said patient the antibody according to claim 23 . 27 . The method of treatment according to claim 26 , wherein said patient suffers from a disease or a condition associated with or caused by an excessive immune response. 28 . The method of treatment according to claim 27 , wherein said disease is selected from the group consisting of autoimmune diseases, transplantation rejection or a graft versus host disease. 29 . The method of treatment according to claim 28 , wherein said disease is an inflammatory disorder. 30 . The method of treatment according to claim 29 , wherein said inflammatory disorder is selected in the group consisting of inflammatory disorder of the nervous system, mucosal inflammatory disease, inflammatory skin disease and autoimmune arthritis. 31 . The method of treatment according to claim 29 , wherein said inflammatory disorder is selected from multiple sclerosis, inflammatory bowel disease, asthma or tonsillitis, dermatitis, psoriasis, contact hypersensitivity and rheumatoid arthritis. 32 . A method for selecting patients susceptible of being treated by anti-ICOS immunotherapy, comprising the step of quantifying ICOS positive Treg cells in a sample of said patient. 33 . An antibody directed against ICOS, wherein said antibody is selected from the group consisting of Icos 53-3, Icos 88-2 and Icos 92-17, respectively obtainable from the hybridoma deposited at the CNCM on Jul. 2, 2009 under the accession numbers CNCM I-4176, CNCM I-4177, CNCM I 4178 and derivatives thereof.
Related publications grouped by family.
Answers are generated from the same data shown on this page.