Antibodies Directed Against ICOS and Uses Thereof

US2016264666A1 · US · A1

Patent metadata
FieldValue
Publication numberUS-2016264666-A1
Application numberUS-201615165152-A
CountryUS
Kind codeA1
Filing dateMay 26, 2016
Priority dateMar 31, 2011
Publication dateSep 15, 2016
Grant date

How to read this patent

A practical reading order for non-experts. Skip the full description unless you need deep technical detail.

  1. Title

    What the patent document calls the invention.

  2. Abstract

    A short plain-language summary of the technical disclosure.

  3. Assignees and inventors

    Who owns or filed the patent and who is credited as inventor.

  4. Key dates

    Filing, priority, publication, and grant dates set the timeline.

  5. First independent claim

    The legal scope of protection — read this for what is actually claimed.

  6. CPC / IPC classifications

    Technology tags used to group this patent with similar filings.

  7. Citations and related patents

    Prior art links and similar publications in this corpus.

Abstract

Official abstract text for this publication.

The present invention provides antibodies directed against ICOS or a derivative thereof which neutralize ICOS engagement on Treg by inhibiting the fixation between ICOS and ICOS-L and abrogate proliferation of Treg induced by plasmacytoid dendritic cells. The present invention further provides antibodies directed against ICOS or a derivative thereof which induce IL-10 and IFNγ production, induce CD4+ T cells proliferation, reduce Tconv proliferation, and increase the immunosuppressive function of Treg.

First claim

Opening claim text (preview).

1 - 22 . (canceled) 23 . An antibody directed against ICOS, wherein said antibody has the following 6 CDRs: Amino acid sequence H-CDR1 GYSFTSYWIN (SEQ ID NO: 23) H-CDR2 NIYPSDSYTNYNQMFKD (SEQ ID NO: 24) H-CDR3 WNLSYYFDNNYYLDY (SEQ ID NO: 25) L-CDR1 RSSKSLLHSNGNTYLY (SEQ ID NO: 26) L-CDR2 RMSNLAS (SEQ ID NO: 27) L-CDR3 MQHLEYPWT (SEQ ID NO: 28) 24 . An antibody according to claim 23 , wherein the nucleotidic sequences encoding the 6 CDRs are the following: DNA sequence H-CDR1 GGCTACAGTTTCACCAGCTACTGGATAAAC (SEQ ID NO: 17) H-CDR2 AATATTTATCCTTCTGATAGTTATACTAAC TACAATCAAATGTTCAAGGAC (SEQ ID NO: 18) H-CDR3 TGGAATCTTTCTTATTACTTCGATAATAAC TACTACTTGGACTAC (SEQ ID NO: 19) L-CDR1 AGGTCTAGTAAGAGTCTCCTGCATAGTAAT GGCAACACTTACTTGTAT (SEQ ID NO: 20) L-CDR2 CGGATGTCCAACCTTGCCTCA (SEQ ID NO: 21) L-CDR3 ATGCAACATCTAGAATATCCGTGGACG (SEQ ID NO: 22) 25 . An antibody according to claim 23 or a derivative thereof which: induces IL-10 and IFNγ production; induces CD4+ T cells proliferation; reduces Tconv proliferation, and increases the immunosuppressive function of Treg. 26 . A method of treatment of a patient in need thereof comprising the step of administering to said patient the antibody according to claim 23 . 27 . The method of treatment according to claim 26 , wherein said patient suffers from a disease or a condition associated with or caused by an excessive immune response. 28 . The method of treatment according to claim 27 , wherein said disease is selected from the group consisting of autoimmune diseases, transplantation rejection or a graft versus host disease. 29 . The method of treatment according to claim 28 , wherein said disease is an inflammatory disorder. 30 . The method of treatment according to claim 29 , wherein said inflammatory disorder is selected in the group consisting of inflammatory disorder of the nervous system, mucosal inflammatory disease, inflammatory skin disease and autoimmune arthritis. 31 . The method of treatment according to claim 29 , wherein said inflammatory disorder is selected from multiple sclerosis, inflammatory bowel disease, asthma or tonsillitis, dermatitis, psoriasis, contact hypersensitivity and rheumatoid arthritis. 32 . A method for selecting patients susceptible of being treated by anti-ICOS immunotherapy, comprising the step of quantifying ICOS positive Treg cells in a sample of said patient. 33 . An antibody directed against ICOS, wherein said antibody is selected from the group consisting of Icos 53-3, Icos 88-2 and Icos 92-17, respectively obtainable from the hybridoma deposited at the CNCM on Jul. 2, 2009 under the accession numbers CNCM I-4176, CNCM I-4177, CNCM I 4178 and derivatives thereof.

Assignees

Inventors

Classifications

  • Immunosuppressants, e.g. drugs for graft rejection · CPC title

  • Drugs for immunological or allergic disorders · CPC title

  • Immunomodulators · CPC title

  • Antivirals · CPC title

  • Antibacterial agents · CPC title

Patent family

Related publications grouped by family.

External sources

Frequently asked questions

Answers are generated from the same data shown on this page.

What does patent US2016264666A1 cover?
The present invention provides antibodies directed against ICOS or a derivative thereof which neutralize ICOS engagement on Treg by inhibiting the fixation between ICOS and ICOS-L and abrogate proliferation of Treg induced by plasmacytoid dendritic cells. The present invention further provides antibodies directed against ICOS or a derivative thereof which induce IL-10 and IFNγ production, induc…
Who is the assignee on this patent?
Inserm (Institut Nat De La Sante Et De La Rech Medicale), Inst Jean Paoli & Irene Calmettes, Univ Aix Marseille, and 2 more
What technology area does this patent fall under?
Primary CPC classification C07K16/2818. Mapped technology areas include Chemistry & Metallurgy.
When was this patent published?
Publication date Thu Sep 15 2016 00:00:00 GMT+0000 (Coordinated Universal Time) (A1). Legal status and post-grant events are not shown on this page.
What related patents are in patentsdb?
We list 1 related publication on this page (citations in our corpus or others sharing the same primary CPC).