Activated reporter protein for the detection of infection in a biological sample

Patent metadata

Field	Value
Publication number	US-2023257734-A1
Application number	US-202118003263-A
Country	US
Kind code	A1
Filing date	Jul 2, 2021
Priority date	Jul 3, 2020
Publication date	Aug 17, 2023
Grant date	—

Abstract

The invention relates to novel means and processes for the detection of a virus in a biological sample comprising cells infected by the virus. In particular, the invention relates to a fluorescent reporter protein designed as a recombinant inactive form of flipGFP suitable for specific activation by viral components in particular by viral proteins, such as viral protease, wherein the viral component recognizes a cleavage site inserted in the recombinant flipGFP. The fluorescent reporter protein is suitable for use in an in vitro method of detection of virus infection in a biological sample when the virus is related to the viral components activating the inactive form of flipGFP into an active fluorescent flipGFP in a biological sample, especially a sample comprising cells, in particular unaltered cells.

First claim

1 . A nucleic acid construct which comprises an operon wherein the operon comprises (a) a recombinant transgene that encodes a recombinant inactive form of a fluorescent reporter protein, and a cleavage site for a viral protease, and (b) a nucleic acid coding for a detectable expression control protein, wherein the nucleic acid sequences of (a) and (b) are operably assembled in said operon under the control of a single promoter and optionally of additional control sequence(s) for transcription and/or translation and wherein the nucleic acid sequences of (a) and (b) are optionally separated by the sequence of a polyprotein separating site such as the sequence of the separating 2A-peptide originating from Thosea asigna virus capsid such as the sequence of SEQ ID No.147.

2 . The nucleic acid construct according to claim 1 , wherein the recombinant transgene encoding the inactive form of the fluorescent reporter protein comprises a nucleotide sequence of an altered form of the Open Reading Frame (ORF) that encodes the active form of the fluorescent reporter protein and wherein said alteration in the ORF comprises switching position in the ORF of at least one nucleotide sequence encoding specific structure domains of the active form of the fluorescent protein to prevent assembly of the expressed structure domains as a functional protein enabling maturation of the chromophore and wherein the nucleotide sequence encoding the inactive form of the fluorescent reporter protein additionally comprises a nucleotide sequence encoding a cleavage site for a determined protease.

3 . The nucleic acid construct according to claim 2 , wherein the nucleic acid coding for a detectable expression control protein is interposed within the sequence encoding the structural domains of the sequence of the active form of a fluorescent reporter protein.

4 . The nucleic acid according to any one of claims 1 to 3 , wherein the active fluorescent reporter protein is an active flipGFP and the inactive fluorescent reporter protein is an inactive flipGFP.

5 . The nucleic acid construct according to claim 4 , wherein the recombinant transgene comprises from 5′-end to 3′-end polynucleotides encoding the beta10 strand of flipGFP, a linker having from 3 to 15, in particular about 10, amino acid residues, the E5 domain of flipGFP, the beta11 strand of flipGFP, the cleavage site of the viral protease and the K5 domain of the flipGFP, the sequence of a polyprotein separating site such as the sequence of the separating 2A-peptide originating from Thosea asigna virus capsid, a polynucleotide encoding the beta1-9 strand of flipGFP wherein these polynucleotides together encode the inactive form of the recombinant flipGFP with the viral protease cleavage site.

6 . The nucleic acid construct according to claim 3 , which comprises from 5′-end to 3′-end polynucleotides encoding the beta1-9 strand of flipGFP, the sequence of a polyprotein separating site such as the sequence of the separating 2A-peptide originating from Thosea asigna virus capsid, the nucleic acid coding for a detectable expression control protein, polynucleotides encoding the beta10 strand of flipGFP, a linker having from 3 to 15, in particular about 10, amino acid residues, the E5 domain of flipGFP, the beta11 strand of flipGFP, the cleavage site of the viral protease and the K5 domain of the flipGFP, wherein these polynucleotides together encode the inactive form of the recombinant flipGFP with the viral protease cleavage site and the detectable expression control protein.

7 . The nucleic acid construct according to any one of claims 1 to 6 , wherein the transgene further comprises upstream from the sequence encoding the inactive fluorescent reporter protein in particular the inactive flipGFP, a sequence encoding a signal peptide, in particular a signal peptide for retention of the expressed polypeptides in the endoplasmic reticulum (ER retention signal) or a signal peptide for targeting the expressed polypeptides to the cell membrane (membrane targeting signal), especially a Cytochrome P450 ER retention signal of sequence MDPVVVLGLCLSCLLLLSLWQSHGGGK (SEQ ID No.105) or a membrane targeting signal of sequence MGCCFSKT (SEQ ID No.107)..

8 . The nucleic acid construct according to any one of claims 1 to 6 , which further comprises operably associated with the sequence encoding the inactive fluorescent reporter protein in particular the inactive flipGFP, a sequence encoding a peptide for retention of the expressed part of the fluorescent reporter polypeptide associated thereto in the endoplasmic reticulum (ER retention signal) or for targeting the expressed polypeptides into the ER membrane or the cell membrane.

9 . The nucleic acid construct according to claim 7 or 8 , which comprises a nucleotide sequence encoding the HCV Core TM peptide that is the sequence of SEQ ID No.152) or encoding the HIV Vpu peptide that is the sequence SEQ ID No.153.

10 . The nucleic acid construct according to claim 7 , wherein the polynucleotide encoding the signal peptide contains or consists of the sequence of ATGGACCCCGTGGTGGTGCTGGGCCTGTGCCTGAGCTGCCTGCTGCTGCTGAG CCTGTGGAAGCAGAGCCACGGCGGCGGCAAG (SEQ ID No.104) encoding the Cytochrome P450 ER retention signal peptide or contains or consists of the sequence of ATGGGCTGCTGCTTCAGCAAGACC (SEQ ID No.106) encoding the membrane targeting signal peptide.

11 . The nucleic acid construct according to claim 9 , wherein the polynucleotide encoding the transmembrane peptide contains or consists of the sequence of SEQ ID No.152 encoding the HCV Core TM peptide for retention into the ER membrane, or the sequence of SEQ ID No.153 encoding the HIV Vpu peptide and this sequence is operably associated with the inactive flipGFP.

12 . The nucleic acid construct according to any one of claims 1 to 11 , wherein the expression control protein is a fluorescent protein with a fluorophore of a color that is different from the color of the reporter fluorescent protein, in particular is mCherry protein or mTurquoise protein or cyan fluorescent protein (ECFP), yellow fluorescent protein such as mVenus, in particular the nucleic acid construct contains the polynucleotide of SEQ ID No.146 coding for mCherry.

13 . The nucleic acid construct according to any one of claims 1 to 12 , wherein the cleavage site is recognized by a protease of a determined virus family selected in the group of Alphaviruses, Coronaviruses, Enteroviruses, Retroviruses and Flaviviruses.

14 . The nucleic acid construct according to any one of claims 1 to 13 , wherein the nucleic acid sequence for the protease cleavage site encodes an amino acid sequence selected from the group of ITTLGKFGQ (SEQ ID No.126) for the Enterovirus 2A protease, EALFQGPK (SEQ ID No.127) or SYFASEQGEIQWV (SEQ ID No.128) for the Enterovirus 3C protease, RAGAYIFS (SEQ ID No.129) for Alphaviruses, RELNGGAYTRYV (SEQ ID No.130), FTLKGGAPTKVT (SEQ ID No.131), IALKGGKIVNNW (SEQ ID No.132), TSAVLQSGFRKM (SEQ ID No.133), KVATVQSKMSDV (SEQ ID No.134), SAVKLQNNELSP (SEQ ID No.135), ATVRLQAGNATE (SEQ ID No.136), REPMLQSADAQS (SEQ ID No.137), SGVTFQSAVKRT (SEQ ID No.138) for SARS-CoV-2 coronavirus, SGVTFQGKFKK (SEQ ID No.139) for SARS virus coronavirus, YAKRGGVF (SEQ ID No140) for Flaviviruses, and more particularly KERKRRGADTSI (SEQ ID No.141), TRSGKRSWPPSE (SEQ ID No.142), EPEKQRSPQDNQ (SEQ ID No.143), GLVKRRGGGTGE (SEQ ID No.144) for ZIKA viruses.

15 . The nucleic acid construct according to any one of claims 1 to 13 , wherein the polynucleotide encoding the viral protease cleavage site consists of a polynucleotide selected from the group of:
GAGGACAGGGCCGGCGCCGGCATCATCGAGACCCCC

Assignees

• Pasteur Institut
• Centre Nat Rech Scient

Inventors

• Meyer Bjorn
• Vignuzzi Marco

Classifications

• C12N15/1055 Primary

  Protein x Protein interaction, e.g. two hybrid selection · CPC title

• C12Q1/37

  involving peptidase or proteinase · CPC title

• C12N9/503 Primary

  derived from viruses · CPC title

• C07K14/43504

  from invertebrates · CPC title

• C07K2319/50

  containing protease site · CPC title