Oligonucleotide compounds for targeting huntingtin mRNA
US-10774327-B2 · Sep 15, 2020 · US
US11230713B2 · US · B2
| Field | Value |
|---|---|
| Publication number | US-11230713-B2 |
| Application number | US-202016811580-A |
| Country | US |
| Kind code | B2 |
| Filing date | Mar 6, 2020 |
| Priority date | Apr 3, 2015 |
| Publication date | Jan 25, 2022 |
| Grant date | Jan 25, 2022 |
A practical reading order for non-experts. Skip the full description unless you need deep technical detail.
What the patent document calls the invention.
A short plain-language summary of the technical disclosure.
Who owns or filed the patent and who is credited as inventor.
Filing, priority, publication, and grant dates set the timeline.
The legal scope of protection — read this for what is actually claimed.
Technology tags used to group this patent with similar filings.
Prior art links and similar publications in this corpus.
Official abstract text for this publication.
This disclosure relates to novel huntingtin targets. Novel oligonucleotides for the treatment of Huntington's disease are also provided.
Opening claim text (preview).
What is claimed: 1. A recombinant adeno-associated virus (rAAV) vector comprising a nucleotide sequence that encodes an RNA duplex; wherein the RNA duplex comprises a sense strand and an antisense strand; wherein the antisense strand is between 16 and 22 nucleotides in length and comprises a region of complementarity; and wherein the region of complementarity in the antisense strand is complementary to at least 16 contiguous nucleotides of 5′ GCCUGCUAGCUCCAUGCUUA 3′ (SEQ ID NO: 17). 2. The rAAV vector of claim 1 , wherein the region of complementarity in the antisense strand is complementary to at least 17 contiguous nucleotides of SEQ ID NO: 17. 3. The rAAV vector of claim 1 , wherein the region of complementarity in the antisense strand is complementary to at least 18 contiguous nucleotides of SEQ ID NO: 17. 4. The rAAV vector of claim 1 , wherein the sense strand is between 16 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 80% identical to SEQ ID NO: 17. 5. The rAAV vector of claim 1 , wherein the sense strand is between 17 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 85% identical to SEQ ID NO: 17. 6. The rAAV vector of claim 1 , wherein the sense strand is between 18 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 90% identical to SEQ ID NO: 17. 7. The rAAV vector of claim 1 , wherein the antisense strand comprises a nucleotide sequence which is at least 85% identical to 5′ UAAGCAUGGAGCUAGCAGGC 3′ (SEQ ID NO: 328). 8. The rAAV vector of claim 1 , wherein the antisense strand comprises a nucleotide sequence which is at least 90% identical to 5′ UAAGCAUGGAGCUAGCAGGC 3′ (SEQ ID NO: 328). 9. The rAAV vector of claim 1 , wherein the antisense strand comprises a nucleotide sequence which is at least 85% identical to 5′ UAAGCAUGGAGCUAGCAGGC 3′ (SEQ ID NO: 328); and wherein the sense strand is between 17 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 85% identical to SEQ ID NO: 17. 10. The rAAV vector of claim 1 , wherein the antisense strand comprises a nucleotide sequence which is at least 90% identical to 5′ UAAGCAUGGAGCUAGCAGGC 3′ (SEQ ID NO: 328); and wherein the sense strand is between 18 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 90% identical to SEQ ID NO: 17. 11. A recombinant adeno-associated virus (rAAV) comprising the rAAV vector of claim 1 and an AAV capsid. 12. A pharmaceutical composition comprising the rAAV of claim 11 and a pharmaceutically acceptable carrier. 13. A recombinant adeno-associated virus (rAAV) comprising the rAAV vector of claim 10 and an AAV capsid. 14. A pharmaceutical composition comprising the rAAV of claim 13 and a pharmaceutically acceptable carrier. 15. A method for inhibiting expression of HTT gene in a cell, the method comprising introducing into the cell the rAAV vector of claim 1 . 16. A method for inhibiting expression of HTT gene in a cell, the method comprising introducing into the cell the rAAV vector of claim 10 . 17. A method of treating Huntington's Disease in a patient, the method comprising administering to the patient a therapeutically effective amount of the rAAV of claim 11 . 18. The method of claim 17 , wherein the rAAV is administered to a putamen of the patient. 19. The method of claim 17 , wherein the rAAV is administered to one or more regions of the parenchyma of the brain, with at least one region being a putamen. 20. The method of claim 17 , wherein administering the rAAV to the patient causes a decrease in HTT gene mRNA in the striatum, the cortex, or both the striatum and the cortex of the patient. 21. A method of treating Huntington's Disease in a patient, the method comprising administering to the patient a therapeutically effective amount of the rAAV of claim 13 . 22. The method of claim 21 , wherein the rAAV is administered to a putamen of the patient. 23. The method of claim 21 , wherein the rAAV is administered to one or more regions of the parenchyma of the brain, with at least one region being a putamen. 24. The method of claim 21 , wherein administering the rAAV to the patient causes a decrease in HTT gene mRNA in the striatum, the cortex, or both the striatum and the cortex of the patient. 25. The method of claim 15 , wherein the cell is: (i) a CNS cell; (ii) a neuronal cell or an astrocyte; or (iii) in a patient. 26. The method of claim 25 , wherein the patient has Huntington's Disease. 27. The rAAV vector of claim 1 , wherein the sense strand, the antisense strand, or both the sense strand and the antisense strand, are each 21 nucleotides in length. 28. The rAAV vector of claim 1 , wherein the sense strand and the antisense strand comprise at least one mismatched base pair. 29. The rAAV vector of claim 28 , wherein the mismatched base pair is present between the 5′ end of the antisense strand and the 3′ end of the sense strand. 30. The rAAV vector of claim 1 , wherein the sense strand, the antisense strand, or both the sense strand and the antisense strand comprise a 3′ overhang of at least 1 or 2 nucleotides.
modulating the chemical stability, e.g. nuclease-resistance · CPC title
branched · CPC title
for the determination of target sites, i.e. of active nucleic acids · CPC title
Fusion with another nucleic acid · CPC title
Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)} · CPC title
Related publications grouped by family.
Answers are generated from the same data shown on this page.