Oligonucleotide compounds for targeting huntingtin mRNA

Patent metadata

Field	Value
Publication number	US-10774327-B2
Application number	US-201916263200-A
Country	US
Kind code	B2
Filing date	Jan 31, 2019
Priority date	Apr 3, 2015
Publication date	Sep 15, 2020
Grant date	Sep 15, 2020

Abstract

This disclosure relates to novel huntingtin targets. Novel oligonucleotides for the treatment of Huntington's disease are also provided.

First claim

What is claimed:

1. A vector comprising a regulatory sequence operably linked to a nucleotide sequence that encodes an RNA duplex comprising a sense strand and an antisense strand wherein the sense strand is between 15 and 30 nucleotides in length and comprises a nucleotide sequence which is at least 80% identical to SEQ ID NO: 1056 and wherein antisense strand comprises a nucleotide sequence which is at least 85% identical to 5′UAAGCAUGGAGCUAGCAGGC3′ (SEQ ID NO: 328) and is complementary to at least 7 contiguous nucleotides of SEQ ID NO: 1056.

2. The vector of claim 1 wherein the antisense strand comprises no more than 3 mismatches with SEQ ID NO: 1056.

3. The vector of claim 1 wherein the antisense strand is complementary to at least 10 contiguous nucleotides of SEQ ID NO: 1056.

4. The vector of claim 1 wherein the antisense strand is complementary to at least 13 contiguous nucleotides of SEQ ID NO: 1056.

5. The vector of claim 4 , wherein the antisense strand comprises a nucleotide sequence which is at least 90% identical to 5′UAAGCAUGGAGCUAGCAGGC3′ (SEQ ID NO: 328); and wherein the sense strand is between 15 and 30 nucleotides in length and comprises a nucleotide sequence which is at least 85% identical to SEQ ID NO: 1056.

6. A recombinant adeno-associated viruses (rAAV) comprising the vector of claim 1 and an AAV capsid.

7. A pharmaceutical composition comprising the rAAV of claim 6 and a pharmaceutically acceptable carrier.

8. A vector comprising a regulatory sequence operably linked to a nucleotide sequence that encodes the RNA duplex of claim 1 .

9. A recombinant adeno-associated viruses (rAAV) comprising the vector of claim 8 and an AAV capsid.

10. A pharmaceutical composition comprising the rAAV of claim 9 and a pharmaceutically acceptable carrier.

11. A method for inhibiting expression of HTT gene in a cell, the method comprising introducing into the cell the RNA duplex of claim 1 or a vector comprising a nucleotide sequence encoding the RNA duplex of claim 1 .

12. A method for inhibiting expression of HTT gene in a cell, the method comprising introducing into the cell the RNA duplex of claim 1 or a vector comprising a nucleotide sequence encoding the RNA duplex of claim 1 .

13. A method of treating Huntington's Disease in a patient, the method comprising administering to the patient a therapeutically effective amount of the rAAV of claim 6 .

14. The method of claim 13 , wherein the rAAV is administered to a putamen of the patient.

15. The method of claim 13 , wherein the rAAV is administered to one or more regions of the parenchyma of the brain, with at least one region being a putamen.

16. The method of claim 13 , wherein administering the rAAV to the patient causes a decrease in HTT gene mRNA in the striatum, the cortex, or both the striatum and the cortex of the patient.

17. A method of treating Huntington's Disease in a patient, the method comprising administering to the patient a therapeutically effective amount of the rAAV of claim 9 .

18. The method of claim 17 , wherein the rAAV is administered to a putamen of the patient.

19. The method of claim 17 , wherein the rAAV is administered to one or more regions of the parenchyma of the brain, with at least one region being a putamen.

20. The method of claim 17 , wherein administering the rAAV to the patient causes a decrease in HTT gene mRNA in the striatum, the cortex, or both the striatum and the cortex of the patient.

Assignees

• Univ Massachusetts

Inventors

• Khvorova Anastasia
• Aronin Neil
• Alterman Julia

Classifications

• C12N2310/14

  interfering nucleic acids [NA] · CPC title

• A61P43/00

  Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00 · CPC title

• A61K31/713

  Double-stranded nucleic acids or oligonucleotides · CPC title

• C12N2310/315

  Phosphorothioates · CPC title

• C12N2320/11

  for the determination of target sites, i.e. of active nucleic acids · CPC title