Cas9-nucleic acid complexes and uses related thereto
US-2015353905-A1 · Dec 10, 2015 · US
US11008588B2 · US · B2
| Field | Value |
|---|---|
| Publication number | US-11008588-B2 |
| Application number | US-201514972927-A |
| Country | US |
| Kind code | B2 |
| Filing date | Dec 17, 2015 |
| Priority date | Jun 17, 2013 |
| Publication date | May 18, 2021 |
| Grant date | May 18, 2021 |
A practical reading order for non-experts. Skip the full description unless you need deep technical detail.
What the patent document calls the invention.
A short plain-language summary of the technical disclosure.
Who owns or filed the patent and who is credited as inventor.
Filing, priority, publication, and grant dates set the timeline.
The legal scope of protection — read this for what is actually claimed.
Technology tags used to group this patent with similar filings.
Prior art links and similar publications in this corpus.
Official abstract text for this publication.
The invention provides for delivery, engineering and optimization of systems, methods, and compositions for manipulation of sequences and/or activities of target sequences. Provided are vectors and vector systems, some of which encode one or more components of a CRISPR complex, as well as methods for the design and use of such vectors. Also provided are methods of directing CRISPR complex formation in prokaryotic and eukaryotic cells to ensure enhanced specificity for target recognition and avoidance of toxicity.
Opening claim text (preview).
What is claimed is: 1. A polynucleotide comprising, from upstream to downstream, a single promoter operably linked to a nucleotide sequence encoding a tandem guide RNA, which tandem guide RNA comprises: (a) a first guide sequence capable of hybridizing to a first target sequence in a eukaryotic cell, (b) a first tracr mate sequence capable of hybridizing to a first tracr sequence, (c) a first tracr sequence, (d) a second guide sequence capable of hybridizing to a second target sequence in a eukaryotic cell, (e) a second tracr mate sequence capable of hybridizing to a second tracr sequence, and (f) a second tracr sequence, wherein (a), (b), (c), (d), (e) and (f) are arranged in a 5′ to 3′ orientation, and (c) and (d) are linked by a nucleotide linker, wherein the nucleotide linker is transcribed from a sequence selected from the group consisting of ATTA, AATTATTA, AATTATTAATTA (SEQ ID NO: 462), AATTATTAATTATAAT (SEQ ID NO: 463), GTTTTAGAGCTATGCT (SEQ ID NO: 464), and GTTTTGAATGGTCCCAAAAC (SEQ ID NO: 465). 2. A composition comprising the polynucleotide of claim 1 for modifying an organism or a non-human organism by manipulation of a first and a second target sequence on opposite strands of a DNA duplex in a genomic locus of interest in a eukaryotic cell, which composition further comprises a polynucleotide sequence encoding a Cas9 protein comprising at least one or more nuclear localization sequences wherein the first guide sequence is capable of directing cleavage of one strand of the DNA duplex near the first target sequence in the eukaryotic cell and the second guide sequence is capable of directing cleavage of the other strand near the second target sequence in the eukaryotic cell inducing a double strand break to modify the organism or the non-human organism. 3. The composition of claim 2 , wherein the nucleotide linker is ATTA or AATTATTA. 4. The composition of claim 2 , wherein the nucleotide linker is AATTATTAATTA (SEQ ID NO: 462). 5. The composition of claim 2 , wherein the nucleotide linker is AATTATTAATTATAAT (SEQ ID NO: 463). 6. The composition of claim 2 , wherein the nucleotide linker is GTTTTAGAGCTATGCT (SEQ ID NO: 464) or GTTTTGAATGGTCCCAAAAC (SEQ ID NO: 465). 7. The composition of claim 2 , wherein the first or second guide sequence, the first or second tracr sequence, and/or the first or second tracr mate sequence are modified. 8. The composition of claim 7 , wherein the modification comprises optimized first or second tracr sequence and/or optimized first or second guide sequence and/or co-fold structure of first or second tracr sequence and/or first or second tracr mate sequence(s) respectively and/or stabilizing secondary structures of first or second tracr sequence and/or first or second tracr sequence with a reduced region of base-pairing and/or first or second tracr sequence fused RNA elements. 9. The composition of claim 2 , wherein any or all of the polynucleotide sequences encoding the Cas9 protein, the first and the second guide sequence, the first and the second tracr mate sequence or the first and the second tracr sequence, is/are RNA. 10. The composition of claim 2 , wherein the polynucleotides encoding the sequence encoding the Cas9 protein, the first and the second guide sequence, the first and the second tracr mate sequence or the first and the second tracr sequence, is/are RNA and are delivered via nanoparticles, exosomes, microvesicles, or a gene-gun. 11. The composition of claim 2 , wherein the first and second tracr mate sequence share 100% identity. 12. The composition of claim 2 , wherein the first and second tracr sequence share 100% identity. 13. The composition of claim 2 , wherein the Cas9 protein is a nuclease or a nickase. 14. The composition of claim 13 , wherein the Cas9 protein is Streptococcus pyogenes Cas9 (SpCas9). 15. A composition comprising the polynucleotide of claim 1 for modifying an organism or a non-human organism by manipulation of a first and a second target sequence on opposite strands of a DNA duplex in a genomic locus of interest in a eukaryotic cell, which composition further comprises a polynucleotide sequence encoding a Cas9 protein comprising at least one or more nuclear localization sequences and comprising one or more mutations, wherein the first guide sequence is capable of directing cleavage of one strand of the DNA duplex near the first target sequence in the eukaryotic cell and the second guide sequence is capable of directing cleavage of the other strand near the second target sequence in the eukaryotic cell inducing a double strand break to modify the organism or the non-human organism. 16. The composition of claim 15 , wherein the first guide sequence capable of directing cleavage of one strand of the DNA duplex near the first target sequence and the second guide sequence capable of directing cleavage of the other strand near the second target sequence are configured to generate a 5′ overhang. 17. The composition of claim 16 , wherein the 5′ overhang is at most 200 base pairs. 18. The composition of claim 16 , wherein the 5′ overhand is at most 100 base pairs. 19. The composition of claim 16 , wherein the 5′ overhang is at most 50 base pairs. 20. The composition of claim 16 , wherein the 5′ overhang is at least 26 base pairs. 21. The composition of claim 16 , wherein the 5′ overhang is at least 30 base pairs. 22. The composition of claim 16 , wherein the 5′ overhang is 34-50 base pairs. 23. The composition of claim 15 , wherein any or all of the polynucleotide sequences encoding the Cas9 protein, the first and the second guide sequence, the first and the second tracr mate sequence or the first and the second tracr sequence, is/are RNA. 24. The composition of claim 15 , wherein the first and second tracr mate sequence share 100% identity. 25. The composition of claim 15 , wherein the first and second tracr sequence share 100% identity. 26. The composition of claim 15 , wherein the Cas9 protein is Streptococcus pyogenes Cas9 (SpCas9). 27. The composition of claim 26 , wherein the Cas9 protein comprises one or more mutations in a catalytic domain. 28. The composition of claim 27 , wherein the Cas9 protein comprises one or more mutations selected from the group consisting of D10A, E762A, H840A, N854A, N863A and D986A. 29. The composition of claim 28 , wherein the Cas9 protein has the D10A mutation. 30. The composition of claim 15 , wherein the modification comprises optimized first or second tracr sequence and/or optimized first or second guide sequence and/or co-fold structure of first or second tracr sequence and/or first or second tracr mate sequence(s) respectively and/or stabilizing secondary structures of first or second tracr sequence and/or first or second tracr sequence with a reduced region of base-pairing and/or first or second tracr sequence fused RNA elements. 31. The composition of claim 15 , wherein the nucleotide linker is ATTA or AATTATTA. 32. The composition of claim 15 , wherein the nucleotide linker is AATTATTAATTA (SEQ ID NO: 462). 33. The composition of claim 15 , wherein the nucleotide linker is AATTATTAATTATAAT (SEQ ID NO: 463). 34. The composition of claim 15 , wherein the nucleotide linker is GTTTTAGAGCTATGCT (SEQ ID NO: 464) or
Ribonucleases {[RNase]; Deoxyribonucleases [DNase]} · CPC title
Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression · CPC title
Preparation or screening gene libraries by chromosomal integration of polynucleotide sequences, HR-, site-specific-recombination, transposons, viral vectors · CPC title
Mutagenizing nucleic acids · CPC title
Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00 · CPC title
Related publications grouped by family.
Answers are generated from the same data shown on this page.