ARID1A and PPP2R1A mutations in cancer

Patent metadata

Field	Value
Publication number	US-9982304-B2
Application number	US-201113819933-A
Country	US
Kind code	B2
Filing date	Sep 6, 2011
Priority date	Sep 3, 2010
Publication date	May 29, 2018
Grant date	May 29, 2018

Abstract

Two genes, ARID1A (AT-rich interactive domain-containing protein 1A) and PPP2R1A (protein-phosphatase 2, regulatory subunit 1, alpha), can be used in methods which are useful for detecting cancer, diagnosing cancer, contributing to a diagnosis of cancer, confirming a diagnosis of cancer, identifying appropriate treatments for cancer, monitoring treatment of cancer, and evaluating treatment protocols for cancer, including ovarian clear cell carcinoma, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, and prostate cancer.

First claim

The invention claimed is:

1. A method, comprising:
amplifying coding regions of ARID1A gene or cDNA in a biological sample of an individual, wherein the biological sample comprises ovarian cells;
sequencing the amplified coding regions of ARID1A gene or cDNA;
detecting a mutation, wherein the mutation is a frameshift or a stop codon in the gene or cDNA.

2. The method of claim 1 , wherein the biological sample is selected from the group consisting of tissue, blood, serum, plasma, ascites, and urine.

3. The method of claim 1 , wherein the individual is suspected of having ovarian cancer.

4. The method of claim 1 , further comprising the step of obtaining the biological sample from the individual.

5. The method of claim 1 , wherein the biological sample is obtained by a method selected from the group consisting of culdocentesis, paracentesis, and biopsy.

6. The method of claim 1 wherein the mutation is hemizgyous in the ovarian cells.

7. The method of claim 1 wherein the mutation is 3854_3855insA.

8. The method of claim 4 , wherein the biological sample is obtained by a method selected from the group consisting of culdocentesis, paracentesis, and biopsy.

9. The method of claim 1 , wherein the individual is suspected of having ovarian clear cell carcinoma (OCCC).

10. The method of claim 1 , wherein the individual has endometriosis.

11. The method of claim 1 , wherein the individual has abdominal swelling due to ascites.

12. The method of claim 1 , wherein the mutation is a stop codon caused by a nonsense mutation.

13. The method of claim 1 wherein the mutation is a frameshift mutation caused by an insertion or a deletion.

14. The method of claim 1 wherein the mutation is selected from the group consisting of mutations:
c.3854_3855insA; c.553C>T; c.903_904dupGT;
c.3659_3684delTGATGGGGCGCATGTCCTATGAGCCA (SEQ ID NO:7), c.585C>A;
c.3391delC; c.4001_4002dupGCA (hom); c.6828_6829delTG(hom); c.1455_1466insCCTAC;
c.4926_4927insTGGC, c.4011_4012delTT (hom); c.4635G>A; c.5202T>A;
486_492delCGCCGCC (hom); c.3575delA; 3223delG; 6718dupG; c.898_899insCGTC;
c.6710_6711insT;1663C>T; c.782_791delCGTCGTCTTC (SEQ ID NO:8);
c.3634_3644delCAGCCCAGTAT (SEQ ID NO:9); c.1873C>T; c.2122C>T; 1804G>T; c.6702delT; c.1341T>G; c.3442delC; c.883dupC; c.2868delC; c.1881delT; and
c.2179_2188delCGGCCACCCA (SEQ ID NO:10) wherein the nucleotides are numbered by reference to SEQ ID NO: 2.

15. The method of claim 1 further comprising:
amplifying mononucleotide repeats in nucleic acids of a biological sample of the individual;
sizing the amplified mononucleotide repeats by electrophoresis.

16. A method, comprising:
testing and detecting in a biological sample of an individual a shortened ARIDIA protein, wherein the biological sample comprises proteins of ovarian cells of the individual which are contacted with an antibody reactive with the N-terminus of the ARID1A protein;
amplifying mononucleotide repeats in nucleic acids of a biological sample of the individual; and
sizing the amplified mononucleotide repeats by electrophoresis.

17. The method of claim 15 wherein the mononucleotide repeats are in an ARID1A gene.

18. The method of claim 16 wherein the mononucleotide repeats are in an ARID1A gene.

19. A method comprising:
amplifying mononucleotide repeats in an ARID1A gene in nucleic acids of a biological sample of an individual, wherein the biological sample comprises ovarian cells;
sizing the amplified mononucleotide repeats by electrophoresis.

Assignees

• Vogelstein Bert
• Kinzler Kenneth W
• Velculescu Victor
• Papadopoulos Nickolas
• Jones Sian
• Univ Johns Hopkins

Inventors

• Vogelstein Bert
• Kinzler Kenneth W
• Velculescu Victor
• Papadopoulos Nickolas
• Jones Sian

Classifications

• G01N33/5011

  for testing antineoplastic activity · CPC title

• C12Q2600/156

  Polymorphic or mutational markers · CPC title

• A61K31/7088

  Compounds having three or more nucleosides or nucleotides · CPC title

• A61K31/711

  Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links · CPC title

• C12Q1/6886 Primary

  for cancer (immunoassay for cancer G01N33/575) · CPC title