Plant eukaryotic translation initiation factor 4E

Patent metadata

Field	Value
Publication number	US-9890422-B2
Application number	US-201113805859-A
Country	US
Kind code	B2
Filing date	Jun 24, 2011
Priority date	Jun 25, 2010
Publication date	Feb 13, 2018
Grant date	Feb 13, 2018

Abstract

The invention relates to plants, and in particular to virus-resistant plants, and to methods of generating such plants. The invention extends to eukaryotic translation initiation factor variants and isoforms thereof, and to nucleic acids involved in the splicing of such variant factors, and uses thereof in methods for producing plants that are resistant to viral infections.

First claim

The invention claimed is:

1. A method for producing a Turnip Mosaic virus-resistant Brassica plant, the method comprising:
(a) isolating a nucleic acid sample from a test Brassica plant;
(b) detecting in the nucleic acid sample, using PCR amplification, the presence of:
(i) a BraA.eIF(iso)4E.a allele encoding a plant eukaryotic initiation factor 4E isoform A (eIF(iso)4E.a) protein that is non-functional for a Turnip Mosaic virus, wherein the eIF(iso)4E.a protein is non-functional because a nucleic acid encoding the eIF(iso)4E.a protein is mis-spliced as a result of an insertion of a guanine at position +1 of the 5′ splice site of intron 1 at the BraA.eIF(iso)4E.a locus; and
(ii) a BraA.eIF(iso)4E.c allele encoding the eIF(iso)4E.c protein comprising an amino acid sequence of SEQ ID NO: 60;
wherein said PCR amplification uses oligonucleotide primers:
1. a forward primer comprising TCTCCTTCCACTTCTTCCCAATAC (SEQ ID NO: 61), and
2. a reverse primer of TAGACAAGGCTTGGCTTGAAACTG (SEQ ID NO: 62);

and wherein a PCR amplification product of 749 basepairs indicates the presence of said BraA.eIF(iso)4E.a allele, and a PCR amplification product of 546 basepairs indicates the presence of said BraA.eIF(iso)4E.c allele;

(c) selecting the test plant as resistant to Turnip Mosaic virus based on the presence of (i) and (ii) above;
(d) crossing the Turnip Mosaic virus-resistant test plant with a susceptible recipient Brassica plant to produce a progeny Brassica plant; and
(e) self-pollinating or selfing the progeny Brassica plant produced in (d) or backcrossing the progeny Brassica plant produced in (d) with the test Brassica plant to produce a further progeny Brassica plant that is (i) homozygous for the allele at the BraA.eIF(iso)4E.a locus, and (ii) is homozygous or heterozygous for the allele at the BraA.eIF(iso)4E.c locus;
to thereby produce a Brassica plant that is resistant to Turnip Mosaic virus.

2. The method according to claim 1 , wherein the recipient plant comprises at least one trait selected from the group consisting of an agronomic advantage, a commercial advantage, and/or suitability for a particular climate or soil.

3. The method according to claim 1 , wherein the test plant is a transgenic plant.

4. The method according to claim 1 , wherein the recipient plant is a Brassica napus plant; a Brassica rapa plant; or a Brassica oleracea plant.

Assignees

• Walsh John Anthony
• Nellist Charlotte Florence
• Barker Guy Cameron
• Jenner Carol Elizabeth
• Syngenta Participations Ag

Inventors

• Walsh John Anthony
• Nellist Charlotte Florence
• Barker Guy Cameron
• Jenner Carol Elizabeth

Classifications

• C07K14/415 Primary

  from plants · CPC title

• C12Q1/686

  Polymerase chain reaction [PCR] · CPC title

• C12Q1/6827 Primary

  for detection of mutation or polymorphism · CPC title

• C12Q1/6816

  characterised by the detection means (C12Q1/6804 takes precedence) · CPC title

• C12Q1/6806

  Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay (C12Q1/6804 takes precedence) · CPC title