Method to assess human allograft status from microrna expression levels

Patent metadata

Field	Value
Publication number	US-9868988-B2
Application number	US-201013256422-A
Country	US
Kind code	B2
Filing date	Mar 15, 2010
Priority date	Mar 13, 2009
Publication date	Jan 16, 2018
Grant date	Jan 16, 2018

Abstract

The invention relates to, among other things, a method for assessing risk of organ rejection in a patient having a transplanted organ. The method includes measuring an amount of expression of a small non-coding marker RNA in a biological sample from the patient. The method further includes comparing the measured amount of expression of the small non-coding marker RNA in the patient to a reference amount of expression of the small non-coding marker RNA. In another aspect, the invention relates to kits for assessing risk of organ rejection in a patient having a transplanted organ.

First claim

What is claimed is:

1. A method comprising:
(a) measuring expression of one or a combination of small non-coding marker RNAs in a sample comprising kidney, blood, and/or urine from a patient by quantitative polymerase chain reaction to generate a measured amount of expression, wherein said one or a combination of small non-coding marker RNA(s) is selected from the group of SEQ. ID NOs: 1-9 and 50;
b) quantifying a difference between the measured amount of expression in step (a) and a reference amount of expression of said one or a combination of small non-coding marker RNAs in a person having a non-rejected organ or a second biological sample from the patient; and
(c) administering an anti-rejection treatment to the patient to reduce a risk of kidney transplant rejection when an increase of expression of at least two-fold is detected of said small non-coding marker RNA(s) in the sample compared to said reference amount.

2. The method according to claim 1 , wherein the small non-coding marker RNA is miR-142-5p CAUAAAGUAGAAAGCACUAC (SEQ ID NO:1).

3. The method according to claim 1 , wherein the small non-coding marker RNA is miR-142-3p UGUAGUGUUUCCUACUUUAUGGA (SEQ ID NO:2).

4. The method according to claim 1 , wherein the small non-coding marker RNA is miR-155 UUAAUGCUAAUCGUGAUAGGGG (SEQ ID) NO:3).

5. The method according to claim 1 , wherein the small non-coding marker RNA is miR-146a UGAGAACUGAAUUCCAUGGGUU (SEQ ID NO:4).

6. The method according to claim 1 , wherein the small non-coding marker RNA is miR-146b UGAGAACUGAAUUCCAUAGGCU (SEQ ID NO:5).

7. The method according to claim 1 , wherein the small non-coding marker RNA is miR-342 UCUCACACAGAAAUCGCACCCGUC (SEQ ID NO:6).

8. The method according to claim 1 , wherein the small non-coding marker RNA is miR-650 AGGAGGCAGCGCUCUCAGGAC (SEQ ID NO:7).

9. The method according to claim 1 , wherein the small non-coding marker RNA is miR-21 UAGCUUAUCAGACUGAUGUUGA (SEQ ID NO:8).

10. The method according to claim 1 , wherein the small non-coding marker RNA is miR-425-5p AAUGACACGAUCACUCCCGUUGA (SEQ ID NO:9).

11. The method according to claim 1 , wherein the small non-coding marker RNA is miR 223 UGUCAGUUUGUCAAAUACCCC (SEQ ID NO:50).

12. The method according to claim 1 , wherein the sample comprises a urine sample.

13. The method according to claim 1 , wherein said reference amount is obtained by measuring an amount of expression of the small non-coding marker RNA(s) in a person having a non-rejected organ.

14. The method according to 1 , wherein said reference amount is obtained by measuring an amount of expression of said small non-coding marker RNA in a second biological sample from the patient.

Assignees

• Suthanthiran Manikkam
• Univ Cornell

Inventors

• Suthanthiran Manikkam

Classifications

• C12Q1/6883 Primary

  for diseases caused by alterations of genetic material · CPC title

• C12Q2600/158

  Expression markers · CPC title

• C12Q2600/16

  Primer sets for multiplex assays · CPC title

• C12Q2600/178

  miRNA, siRNA or ncRNA · CPC title

• C12Q2600/156

  Polymorphic or mutational markers · CPC title