Therapeutic nanoparticles and methods of use thereof

Patent metadata

Field	Value
Publication number	US-9763891-B2
Application number	US-201214233215-A
Country	US
Kind code	B2
Filing date	Jul 19, 2012
Priority date	Jul 22, 2011
Publication date	Sep 19, 2017
Grant date	Sep 19, 2017

Abstract

Provided herein are therapeutic nanoparticles having a diameter of between 10 nm to 30 nm, and containing a polymer coating, and a nucleic acid containing a sequence complementary to a sequence within a micro-RNA identified as having a role in cancer cell metastasis or anti-apoptotic activity in a cancer cell (e.g., miR-10b) or a sequence within an mRNA encoding a pro-apoptotic protein that is covalently linked to the nanoparticle. Also provided are pharmaceutical compositions containing these therapeutic nanoparticles. Also provided herein are methods of decreasing cancer cell invasion or metastasis in a subject having a cancer and methods of treating a metastatic cancer in a lymph node in a subject that require the administration of these therapeutic nanoparticles to a subject.

First claim

What is claimed is:

1. A therapeutic nanoparticle, wherein the therapeutic nanoparticle comprises:
a polymer coating, and
a nucleic acid comprising at least 10 contiguous nucleotides within the sequence of CACAAATTCGGTTCTACAGGGTA (SEQ ID NO: 18) that is covalently linked to the therapeutic nanoparticle,
wherein the therapeutic nanoparticle further comprises a covalently-linked targeting peptide.

2. The therapeutic nanoparticle of claim 1 , wherein the nucleic acid comprises SEQ ID NO: 18.

3. The therapeutic nanoparticle of claim 1 , wherein the nucleic acid comprises at least one modified nucleotide.

4. The therapeutic nanoparticle of claim 3 , wherein the at least one modified nucleotide is a locked nucleotide.

5. The therapeutic nanoparticle of claim 1 , wherein the therapeutic nanoparticle further comprises a covalently-linked fluorophore.

6. The therapeutic nanoparticle of claim 5 , wherein the fluorophore absorbs near-infrared light.

7. The therapeutic nanoparticle of claim 5 , wherein the fluorophore is covalently-linked to the therapeutic nanoparticle through a chemical moiety comprising a secondary amine.

8. The therapeutic nanoparticle of claim 1 , wherein the targeting peptide comprises: an RGD peptide, an EPPT peptide, NYLHNHPYGTVG (SEQ ID NO: 11), SNPFSKPYGLTV (SEQ ID NO: 12), GLHESTFTQRRL (SEQ ID NO: 13), YPHYSLPGSSTL (SEQ ID NO: 14), SSLEPWHRTTSR (SEQ ID NO: 15), or LPLALPRHNASV (SEQ ID NO: 16), or βAla-(Arg)7-Cys (SEQ ID NO: 19).

9. The therapeutic nanoparticle of claim 8 , wherein the targeting peptide is covalently-linked to the therapeutic nanoparticle through a chemical moiety comprising a disulfide bond.

10. The therapeutic nanoparticle of claim 1 , wherein the polymer coating comprises dextran.

11. The therapeutic nanoparticle of claim 1 , wherein the nucleic acid is covalently-linked to the therapeutic nanoparticle through a chemical moiety comprising a disulfide bond or a thioether bond.

12. The therapeutic nanoparticle of claim 1 , wherein the therapeutic nanoparticle is magnetic.

13. A pharmaceutical composition comprising the therapeutic nanoparticle of claim 1 and a pharmaceutically acceptable carrier.

Assignees

• Medarova Zdravka
• Yigit Mehmet V
• Moore Anna
• Massachusetts Gen Hospital

Inventors

• Medarova Zdravka
• Yigit Mehmet V
• Moore Anna

Classifications

• A61P35/04

  specific for metastasis · CPC title

• C12N2320/31

  Combination therapy · CPC title

• C12N2310/14

  interfering nucleic acids [NA] · CPC title

• B82Y5/00

  Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery · CPC title

• C12N2310/3231

  having an additional ring, e.g. LNA, ENA · CPC title