Intestinal mononuclear phagocytes as prognostic biomarker for crohn's disease
US-2024425923-A1 · Dec 26, 2024 · US
US9758826B2 · US · B2
| Field | Value |
|---|---|
| Publication number | US-9758826-B2 |
| Application number | US-201113163326-A |
| Country | US |
| Kind code | B2 |
| Filing date | Jun 17, 2011 |
| Priority date | Jun 24, 2010 |
| Publication date | Sep 12, 2017 |
| Grant date | Sep 12, 2017 |
A practical reading order for non-experts. Skip the full description unless you need deep technical detail.
What the patent document calls the invention.
A short plain-language summary of the technical disclosure.
Who owns or filed the patent and who is credited as inventor.
Filing, priority, publication, and grant dates set the timeline.
The legal scope of protection — read this for what is actually claimed.
Technology tags used to group this patent with similar filings.
Prior art links and similar publications in this corpus.
Official abstract text for this publication.
p53-upregulated modulator of apoptosis (PUMA) is a biomarker associated with islet cell health. If PUMA is low, islet cells are typically healthy. If PUMA is high, islet cells are typically unhealthy or dying. PUMA may be measured by either measuring its nucleic or amino acid. PUMA mRNA may be induced by TNF-α stimulation in a time- and dose-dependent manner and β cell apoptosis is induced through a mitochondrial pathway. TNF-α significantly inhibited glucose-induced preproinsulin precursor mRNA synthesis. Such β cell stress signaling in human islets indicates overall state of islet health and, ultimately, the risk of onset and/or degree of severity of both type 1 and type 2 diabetes mellitus.
Opening claim text (preview).
The invention claimed is: 1. A method of treating hyperglycemia or diabetes in a subject comprising: determining whether an islet is a candidate for transplant, comprising: quantifying an expression level of p53 upregulated modulator of apoptosis (PUMA) messenger RNA (mRNA) comprising: reverse transcribing an RNA sample from the islet, forming a first cDNA sample, and amplifying the first cDNA sample to determine the expression level of PUMA mRNA, wherein the expression level of PUMA is determined by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR); quantifying an expression level of pre-spliced preproinsulin mRNA comprising; reverse transcribing the RNA sample from the islet, forming a second cDNA sample, and amplifying the second cDNA sample to determine the expression level of pre-spliced preproinsulin mRNA, wherein the expression level of pre-spliced preproinsulin mRNA is determined by qRT-PCR; determining the islet is a candidate for transplant when the expression level of pre-spliced preproinsulin mRNA is greater than the expression level of PUMA mRNA; and transplanting islets that are equivalent to the islet determined to be a candidate for transplant into the subject to treat the hyperglycemia or diabetes. 2. The method of claim 1 , wherein the expression level of PUMA is normalized to an expression level of a control gene and the expression level of pre-spliced preproinsulin mRNA is normalized to an expression level of pre- and post-spliced preproinsulin mRNA. 3. The method of claim 1 , wherein the islet is a candidate for transplant when the expression level of PUMA mRNA is less than a cutoff value of 0.5. 4. The method of claim 1 , wherein the subject is suffering from hyperglycemia or diabetes and the transplanted islets reverse the hyperglycemia or diabetes. 5. The method of claim 1 , wherein one or more nucleotide probe pairs are used to perform qRT-PCR of pre-spliced preproinsulin mRNA. 6. The method of claim 5 , wherein the one or more nucleotide probe pairs comprise: AGGTGGGCTCAGGATTCCA (SEQ ID NO.1) (In1 upstream) and TCACCCCCACATGCTTCAC (SEQ ID NO.2) (In1 downstream); ACTCGCCCCTCAAACAAATG (SEQ ID NO.3) (In2 upstream) and TGAATCTGCGGTCATCAAATG (SEQ ID NO.4) (In2 downstream); CTCTGCCTCGCCGCTGTTC (SEQ ID NO.5) (In2Ex3 upstream) and TCCACAATGCCACGCTTCTG (SEQ ID NO.6) (In2Ex3 downstream); GCAGCCTTTGTGAACCAACA (SEQ ID NO.7) (Ex2a upstream) and TTCCCCGCACACTAGGTAGAGA (SEQ ID NO.8) (Ex2a downstream); GGGAACGAGGCTTCTTCTACAC (SEQ ID NO.9) (Ex2b upstream) and CCACAATGCCACGCTTCTG (SEQ ID NO.10) (Ex2b downstream); and CATTGTGGAACAATGCTGTACCA (SEQ ID NO.11) (Ex3 upstream) and GCCTGCGGGCTGCGTCTA (SEQ ID NO.12) (Ex3 downstream).
p53 · CPC title
Pancreatic cells · CPC title
for diseases caused by alterations of genetic material · CPC title
Expression markers · CPC title
Screening for pharmacological compounds · CPC title
Related publications grouped by family.
Answers are generated from the same data shown on this page.