Viruses associated with immunodeficiency and enteropathy and methods using same

Patent metadata

Field	Value
Publication number	US-9683268-B2
Application number	US-201314429559-A
Country	US
Kind code	B2
Filing date	Sep 19, 2013
Priority date	Sep 19, 2012
Publication date	Jun 20, 2017
Grant date	Jun 20, 2017

Abstract

The present invention relates to previously undescribed viruses that are associated with significant expansion of the virome, immunodeficiency, and enteropathy during lentiviral infection. The invention also provides methods to detect acquired immune deficiency syndrome (AIDS) or AIDS progression in a subject, methods to diagnose immunodeficiency or enteropathy in a subject, and methods to identify a therapeutic agent to treat the same.

First claim

What is claimed is:

1. A method of detecting acquired immune deficiency syndrome (AIDS) and/or AIDS progression in a subject infected with HIV or SIV, said method comprising:
a) synthesizing cDNA from RNA comprising a biological sample obtained from a subject;
b) synthesizing cDNA from RNA comprising a control sample;
c) detecting in each sample the quantity of WUHARV Adenovirus 1 by a PCR assay using primer pairs selected from the group consisting of GGCAATCATGATGGACACCTT(SEQ ID: 332)and TTAATCACCACCGCAACGC (SEQ ID NO:3:33), CAATGGAACATTAATCCCACG (SEQ ID NO: 334) and CCTGCCAACACTCCCATATTT (SEQ ID NO: 335), and AGAGCTATCACACAGCGTTCA (SEQ ID NO: 366) ACCGAGTGGTGGAGGAGAA (SEQ ID NO: 337), wherein the PCR assay is selected from the group consisting of a real time PCR assay and a nested PCR assay;
d) determining the magnitude of difference between the quantity of WUHARV Adenovirus 1 in said biological sample relative to the quantity of WUHARV Adenovirus 1 in said control sample; and
e) detecting CD4 T cell levels in the subject and in a control, wherein a statistically significant increase in the quantity of WUHARV Adenovirus 1, and a decrease in CD4 T cell levels in said subject, relative to the control, indicates AIDS and/or AIDS progression in said subject.

2. The method of claim 1 , wherein said sample is a tissue, organ, liquid, or feces sample.

3. The method of claim 2 , wherein said subject is a mammal.

4. The method of claim 3 , wherein said mammal is a primate.

5. The method of claim 4 , wherein said primate is a human.

6. The method of claim 1 , wherein said sample is a feces sample.

7. The method of claim 1 , further comprising detecting serum LBP binding protein (LBP) levels in the subject and in a control, wherein an increase in LBP levels in the subject relative to the control indicates AIDS progression.

Assignees

• Beth Israel Deaconess Medical Ct Inc
• Univ Washington
• Beth Israel Deaconess

Inventors

• Barouch Dan
• Virgin Herbert W
• Wang David
• Zhao Guoyan
• Thackray Larissa
• Handley Scott
• Presti Rachel

Classifications

• C12N2770/32321

  Viruses as such, e.g. new isolates, mutants or their genomic sequences · CPC title

• C12N2710/22021

  Viruses as such, e.g. new isolates, mutants or their genomic sequences · CPC title

• C12N2750/14121

  Viruses as such, e.g. new isolates, mutants or their genomic sequences · CPC title

• C12N2770/32021

  Viruses as such, e.g. new isolates, mutants or their genomic sequences · CPC title

• C12N2770/16021

  Viruses as such, e.g. new isolates, mutants or their genomic sequences · CPC title