Antibodies directed against ICOS and uses thereof

Patent metadata

Field	Value
Publication number	US-9676852-B2
Application number	US-201615165152-A
Country	US
Kind code	B2
Filing date	May 26, 2016
Priority date	Mar 31, 2011
Publication date	Jun 13, 2017
Grant date	Jun 13, 2017

Abstract

The present invention provides antibodies directed against ICOS or a derivative thereof which neutralize ICOS engagement on Treg by inhibiting the fixation between ICOS and ICOS-L and abrogate proliferation of Treg induced by plasmacytoid dendritic cells. The present invention further provides antibodies directed against ICOS or a derivative thereof which induce IL-10 and IFNγ production, induce CD4+ T cells proliferation, reduce Tconv proliferation, and increase the immunosuppressive function of Treg.

First claim

The invention claimed is:

1. A method of treatment of cancer in a patient in need thereof, the method comprising administering to the patient an antibody directed against human Inducible T-cell costimulator (ICOS), wherein said antibody competes for binding to human ICOS with an antibody having the following 6 CDRs:

(SEQ ID NO: 7, H-CDR1)

GYTFTTYWMH;

(SEQ ID NO: 8, H-CDR2)

EIDPSDSYVNYNQNFKG;

(SEQ ID NO: 9, H-CDR3)

FDY;

(SEQ ID NO: 10, L-CDR1)

RSSKSPLHSNGNIYLY;

(SEQ ID NO: 11, L-CDR2)

RMSNLAS;

(SEQ ID NO: 12, L-CDR3)

MQHLEYPYT.

2. The method of treatment according to claim 1 , wherein the nucleotide sequences encoding the 6 CDRs are:

(SEQ ID NO: 1, H-CDR1)

GGCTACACCTTCACCACCTACTGGATGCAC;

(SEQ ID NO: 2, H-CDR2)

GAGATTGATCCTTCTGATAGTTATGTTAACTACAATCAAAACTTTAAGGG

C;

(SEQ ID NO: 3, H-CDR3)

TTTGATTAC;

(SEQ ID NO: 4, L-CDR1)

AGGTCTAGTAAGAGTCCCCTGCATAGTAACGGCAACATTTACTTATAT;

(SEQ ID NO: 5, L-CDR2)

CGGATGTCCAACCTTGCCTCA;

(SEQ ID NO: 6, L-CDR3)

ATGCAACATCTAGAATATCCGTACACG.

3. The method of treatment according to claim 1 , wherein said cancer is human malignant lymphoma.

4. The method of treatment according to claim 1 , wherein said cancer is ovarian cancer.

5. The method of treatment according to claim 1 , wherein said cancer is cervical cancer.

6. The method of treatment according to claim 1 , wherein said cancer is breast cancer.

7. The method of treatment according to claim 1 , wherein said cancer is colon cancer.

8. The method of treatment according to claim 1 , wherein said cancer is lung cancer.

9. The method of treatment according to claim 1 , wherein said cancer is prostate cancer.

10. The method of treatment according to claim 1 , wherein said cancer is head and neck cancer.

11. The method of treatment according to claim 1 , wherein said cancer is pancreatic cancer.

12. The method of treatment according to claim 1 , wherein said cancer is bladder cancer.

13. The method of treatment according to claim 1 , wherein said cancer is colorectal cancer.

14. The method of treatment according to claim 1 , wherein said cancer is kidney cancer.

15. The method of treatment according to claim 1 , wherein said cancer is stomach cancer.

16. The method of treatment according to claim 1 , wherein said cancer is skin cancer.

17. The method of treatment according to claim 1 , wherein said cancer is esophageal cancer.

Assignees

• Inserm (Institut Nat De La Sante Et De La Rech Medicale)
• Inst Jean Paoli & Irene Calmettes
• Univ Aix Marseille
• Univ Claude Bernard—Lyon 1
• Centre Leon Berard

Inventors

• Faget Julien
• Caux Christophe
• Menetrier-Caux Christine
• Nunes Jacques
• Olive Daniel

Classifications

• A61P37/02

  Immunomodulators · CPC title

• A61P37/00

  Drugs for immunological or allergic disorders · CPC title

• A61P37/06

  Immunosuppressants, e.g. drugs for graft rejection · CPC title

• A61P29/00

  Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID] · CPC title

• A61P31/00

  Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics · CPC title