Optimized expression cassette for expressing a polypeptide with high yield

Patent metadata

Field	Value
Publication number	US-9663797-B2
Application number	US-201314443863-A
Country	US
Kind code	B2
Filing date	Nov 18, 2013
Priority date	Nov 20, 2012
Publication date	May 30, 2017
Grant date	May 30, 2017

Abstract

The present invention is based on the finding that the combination of a specific 5′UTR polynucleotide sequence (see SEQ ID NO 1) and the hCD33 secretory leader sequence in an expression cassette for expressing a polypeptide of interest results in a surprisingly better expression level of the polypeptide of interest compared to prior art expression cassettes. Based on this finding, the present invention inter alia provides novel expression cassettes, expression vectors and methods for producing a polypeptide of interest with high yield.

First claim

The invention claimed is:

1. An expression cassette suitable for expressing a polypeptide of interest comprising:
a) a promoter;
b) a 5′UTR polynucleotide sequence, wherein said 5′UTR polynucleotide sequence is selected from the group consisting of
i) a 5′UTR polynucleotide sequence comprising the following sequence

(SEQ ID NO 6)

agatcgcctggagacgccatccacgctgttttgacctccatagaagacac

cgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggat

tccccgtgccaagagtgacgtaagtaccgcctatagagtctataggccca

cccccttggcttcgttagaacgcggctacaattaatacataaccttatgt

atcatacacatacgatttaggtgacactatagaataacatccactttgcc

tttctctccacaggtgtccactcccaggtccaactgcacctcggttctat

cgaaaaacgcgtgccgccacc;

and
ii) a 5′UTR polynucleotide sequence comprising the following sequence

(SEQ ID NO 7)

agatcgcctggagacgccatccacgctgttttgacctccatagaagacac

cgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggat

tccccgtgccaagagtgacgtaagtaccgcctatagagtctataggccca

cccccttggcttcgttagaacgcggctacaattaatacataaccttatgt

atcatacacatacgatttaggtgacactatagaataacatccactttgcc

tttctctccacaggtgtccactcccaggtccaactgcacctcggttctat

cgaaaacgcgtgccgccacc;

c) a polynucleotide encoding a hCD33 secretory leader sequence; and
d) a polynucleotide encoding a polypeptide of interest or an insertion site for inserting a polynucleotide encoding a polypeptide of interest.

2. The expression cassette of claim 1 , wherein the hCD33 secretory leader sequence consists of the sequence MPLLLLLPLLWAGALA (SEQ ID NO: 12).

3. The expression cassette of claim 1 , wherein said expression cassette further comprises
e) a 3′UTR sequence and/or
f) a poly A signal.

4. The expression cassette of claim 1 wherein the polynucleotide encoding the polypeptide of interest encodes as polypeptide of interest, two or more subunits or domains of a dimeric or multimeric protein, wherein at least one IRES element is located between the coding regions of the individual subunits or domains and each coding region is preceded by an hCD33 secretory leader sequence.

5. An expression vector for expressing a polypeptide of interest, comprising at least one expression cassette of claim 1 , additionally comprising one or more of the following elements:
a) at least one expression cassette comprising a polynucleotide encoding a selectable marker;
b) at least one second expression cassette for expressing a polypeptide of interest.

6. A eukaryotic host cell comprising at least one expression cassette of claim 1 .

7. The host cell of claim 6 , wherein said host cell is selected from the group consisting of rodent cells, primate cells and human cells and wherein said host cell preferably is a CHO cell.

8. A method for producing a polypeptide of interest, said method comprising culturing the eukaryotic host cells of claim 6 in a cell culture under conditions allowing expression of said polypeptide of interest.

9. The method of claim 8 , wherein said polypeptide of interest is secreted into the cell culture medium and is isolated from the cell culture medium and the isolated polypeptide is optionally further processed.

10. The method of claim 8 , wherein said polypeptide is an immunoglobulin molecule or fragment thereof.

11. The expression cassette of claim 1 , wherein the polynucleotide encoding the polypeptide of interest encodes as polypeptide of interest, two or more subunits or domains of a dimeric or multimeric protein, wherein at least one IRES element is located between the coding regions of the individual subunits or domains and each coding region is preceded by an hCD33 secretory leader sequence.

12. The expression cassette of claim 1 , wherein the expression cassette is a monocistronic expression cassette.

13. The expression cassette of claim 1 wherein the 5′UTR polynucleotide sequence comprises SEQ ID NO: 6.

14. The expression cassette of claim 1 wherein the 5′UTR polynucleotide sequence comprises SEQ ID NO: 7.

Assignees

• Dragic Zorica
• Geisse Sabine
• Schmitz Rita
• Wilms Burkhard
• Novartis Ag

Inventors

• Dragic Zorica
• Geisse Sabine
• Schmitz Rita
• Wilms Burkhard

Classifications

• C12N2830/00

  Vector systems having a special element relevant for transcription · CPC title

• C12N15/85 Primary

  for animal cells · CPC title

• C07K16/00 Primary

  Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies · CPC title

• C12N2830/30

  being an enhancer not forming part of the promoter region · CPC title