Multi-targeting short interfering RNAs

Patent metadata

Field	Value
Publication number	US-9487785-B2
Application number	US-201414579313-A
Country	US
Kind code	B2
Filing date	Dec 22, 2014
Priority date	Jan 29, 2007
Publication date	Nov 8, 2016
Grant date	Nov 8, 2016

Abstract

The present invention relates to novel short interfering RNA (siRNA) molecules that are multi-targeted. More specifically, the present invention relates to siRNA molecules that target two or more sequences. In one embodiment, multi-targeting siRNA molecules are designed to incorporate features of siRNA molecules and features of micro-RNA (miRNA) molecules. In another embodiment, multi-targeting siRNA molecules are designed so that each strand is directed to separate targets.

First claim

What is claimed is:

1. A method of treating HIV-1 infection which comprises administering a therapeutically effective amount of a multi-targeting RNA molecule to an individual in need thereof, wherein the multi-targeting RNA molecule targets two or more different desired target sequences, wherein the RNA molecule comprises a first strand having a 5′ terminus and a 3′ terminus and a second strand having a 5′ terminus and a 3′ terminus, wherein the first strand is perfectly complementary to a desired mRNA target sequence, wherein the second strand contains two or more seed matches optimally spaced in a desired 3′ UTR containing target gene, wherein the first strand and second strand are not completely complementary and wherein the first strand and the second strand hybridize to form a double stranded RNA molecule, wherein the double stranded RNA molecule is a single duplex, wherein the first strand and the second strand have nucleotide sequences selected from the following group:

(a)

first strand:
(SEQ ID NO: 46)

5′ uccaaucugcuugaagacuagggauuc 3′

and

second strand:
(SEQ ID NO: 45)

5′ uuccccagucaaaaguccaauugga 3′;

(b)

first strand:
(SEQ ID NO: 48)

5′ cgcucgggagccucuugcuggaagaua 3′

and

second strand:
(SEQ ID NO: 47)

5′ uuccccagucaaaaguccacgagctg 3′;

(c)

first strand:
(SEQ ID NO: 50)

5′ aaaccugaagcucucuucugguggggcu 3′

and

second strand: 
(SEQ ID NO: 49)

5′ uuccccagucaaaaguccaagguuu 3′;

and

(d)

first strand:
(SEQ ID NO: 52)

5′ ggauaucugaccccuggcccuggugugu 3′

and

second strand: 
(SEQ ID NO: 51)

5′ uuccccagucaaaaguccaauaucc 3′.

2. The method of claim 1 , wherein the optimal spacing between seed matches is between 13 and 100 nucleotides.

3. The method of claim 2 , wherein the optimal spacing between seed matches is between 13 and 35 nucleotides.

4. The method of claim 1 , wherein the first strand results in cleavage of the desired mRNA target sequence and wherein the seed matches result in down-regulation of the desired 3′ UTR containing target gene.

5. The method of claim 4 , wherein the desired mRNA target sequence and the desired 3′ UTR containing target gene are the same gene.

6. The method of claim 5 , wherein the gene is an HIV gene.

7. The method of claim 4 , wherein the desired mRNA target sequence is a target sequence of a first desired gene and the desired 3′ UTR containing target gene is a second desired gene.

8. The method of claim 7 , wherein the first desired gene is CCR5 and the second desired gene is 3′ UTR of HIV.

Assignees

• Hope City

Inventors

• Rossi John J
• Snove Jr Ola
• Ehsani Ali
• Saetrom Jr Pal
• Vallazza Britta
• Zhang Jane
• Aagaard Lars

Classifications

• A61P35/04

  specific for metastasis · CPC title

• A61P9/00

  Drugs for disorders of the cardiovascular system · CPC title

• A61P5/00

  Drugs for disorders of the endocrine system · CPC title

• A61P29/00

  Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID] · CPC title

• A61P25/00

  Drugs for disorders of the nervous system · CPC title