Production and use of rat spermatogonial stem cell lines

Patent metadata

Field	Value
Publication number	US-9474254-B2
Application number	US-201414286468-A
Country	US
Kind code	B2
Filing date	May 23, 2014
Priority date	Dec 1, 2008
Publication date	Oct 25, 2016
Grant date	Oct 25, 2016

Abstract

A spermatogonial stem cell line that is derived from testes of rats characterized by a desirable genetic background can serve as a source for cells to transplant into male-sterile recipient animals that are immuno-compatible with the spermatogonial line. Rat cells thus transplanted readily develop into fertilization-competent, haploid male gametes, with little or no endogenous sperm competition generated by the testes of the male-sterile recipient. This approach, constituting the first vector system for the use of rat spermatogonial lines from in vitro culture in generating mutant rats on a desired genetic background, effects maximal germline transmission of donor haplotypes from the transplanted spermatogonial cells.

First claim

What is claimed is:

1. A method of introducing a transgene or a mutation into the genome of a male rat wherein said male rat is DAZL-deficient, comprising:
a) providing a cultured rat spermatogonial stem cell line of a predetermined genetic background;
(b) genetically modifying the rat spermatogonial stem cell line by gene-trap insertion mutagenesis with a transposon plasmid containing a gene-trap selection cassette comprising transposase binding sites necessary for transposition to generate a rat donor haplotype, wherein a transposon insertion site can be remobilized by the expression of a transposase recognizing the transposase binding sites in the stem cell line in culture or at a later stage in vivo;
(c) transplanting the genetically modified rat spermatogonial stem cell line of a predetermined genetic background into a testicle of the male rat; and
(d) allowing a time sufficient for the genetically modified rat spermatogonial stem cell line to develop into fertilization-competent, haploid male gametes, wherein DAZL-deficient rats transmitted the rat donor haplotype more efficiently than from wildtype rat recipient testes.

2. The method of claims 1 , wherein the male rat expresses a small hairpin RNA transgene that degrades DAZL mRNA.

3. The method of claims 1 , wherein the predetermined genetic background is Sprague Dawley.

4. The method of claims 1 , wherein the predetermined genetic background is Fisher 344.

5. The method of claims 1 , wherein the donor haplotype comprises an internal tandem repeat (ITR) from a transposon.

6. The method of claims 1 , wherein the donor haplotype comprises at least two fragments of a transposon sequence comprising the nucleotides of SEQ ID NO:3 and SEQ ID NO:4;

CCCTAGAAAGATAGTCTGCGTAAAATTGACGCATGCATTCTTGAAATATT

GCTCTCTCTTTCTAAATAGCGCGAATCCGTCGCTGTGCATTTAGGACATC

TCAGTCGCCGCTTGGAGCTCCCGTGAGGCGTGCTTGTCAATGCGGTAAGT

GTCACTGATTTTGAACTATAACGACCGCGTGAGTCAAAATGACGCATGAT

TATCTTTTACGTGACTTTTAAGATTTAACTCATACGATAATTATATTGTT

ATTTCATGTTCTACTTACGTGATAACTTATTATATATATATTTTCTTGTT

ATAGATATC(SEQ ID NO: 3)

and

TAAAAGTTTTGTTACTTTATAGAAGAAATTTTGAGTTTTTGTTTTTTTTT

AATAAATAAATAAACATAAATAAATTGTTTGTTGAATTTATTATTAGTAT

GTAAGTGTAAATATAATAAAACTTAATATCTATTCAAATTAATAAATAAA

CCTCGATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTA

TCTTTAACGTACGTCACAA the nucleotides of  

SEQ ID NO: 3 and SEQ ID NO: 4

wherein the fragments flank a mutated genetic sequence of interest.

7. The method of claims 1 , wherein the donor haplotype comprises the nucleotides of SEQ ID NO:5 and SEQ ID NO:6;

CCCTAGAAAGATAGTCTGCGTAAAATTGACGCATG

and

CATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCACAA

TATGATTAT the nucleotides of  

SEQ ID NO: 5 and SEQ ID NO: 6

wherein the fragments flank a mutated genetic sequence of interest.

8. The method of claims 1 , wherein the donor haplotype comprises a fragment of a transposon sequence consisting of the PiggyBac 5′ ITR and the PiggyBac 3′ ITR.

9. The method of claims 1 , wherein the donor haplotype comprises a fragment of a transposon sequence consisting of the Sleeping Beauty 5′ ITR and the Sleeping Beauty 3′ ITR.

10. A method of restoring male fertility to a DAZL-deficient rat, comprising the steps of:
(a) culturing an isolated rat spermatogonial stem cell line of a predetermined genetic background;
(b) genetically modifying the rat spermatogonial stem cell line by gene-trap insertion mutagenesis with a transposon plasmid containing a gene-trap selection cassette and a helper plasmid encoding a transposase to generate a rat donor haplotype;
(c) transplanting the rat spermatogonial stem cell line of a predetermined genetic background into the a testicle of the male DAZL-deficient rat; wherein the genome of the modified rat spermatogonial stem cell line comprises a transposon sequence or a fragment thereof; and
(d) allowing a time sufficient for the genetically modified rat spermatogonial stem cell line to develop into fertilization-competent, haploid male gametes.

11. The method of claims 10 , wherein the male rat expresses a small hairpin RNA transgene that degrades DAZL mRNA.

12. The method of claims 10 , wherein the predetermined genetic background is Sprague Dawley.

13. The method of claims 10 , wherein the predetermined genetic background is Fisher 344.

14. The method of claims 10 , wherein the donor haplotype comprises an internal tandem repeat (ITR) from a transposon.

15. The method of claims 10 , wherein the donor haplotype comprises the nucleotides of SEQ ID NO:5 and SEQ ID NO:6;
wherein the fragments flank a mutated genetic sequence of interest.

16. The method of claims 10 , wherein the donor haplotype comprises the nucleotides of SEQ ID NO:5 and SEQ ID NO:6;
wherein the fragments flank a mutated genetic sequence of interest.

17. The method of claims 10 , wherein the donor haplotype comprises a fragment of a transposon sequence consisting of the PiggyBac 5′ ITR and the PiggyBac 3′ ITR.

18. The method of claims 10 , wherein the donor haplotype comprises a fragment of a transposon sequence consisting of the Sleeping Beauty 5′ ITR and the Sleeping Beauty 3′ ITR.

Assignees

• Univ Texas

Inventors

• Hamra Franklin Kent

Classifications

• A01K67/0271 Primary

  Chimeric vertebrates, e.g. comprising exogenous cells · CPC title

• C12N2800/90

  Vectors containing a transposable element · CPC title

• C12N2501/115

  Basic fibroblast growth factor (bFGF, FGF-2) · CPC title

• C12N2500/44

  Thiols, e.g. mercaptoethanol · CPC title

• A01K2217/07

  Animals genetically altered by homologous recombination · CPC title