Detection and destruction of cancer cells using programmed genetic vectors

Patent metadata

Field	Value
Publication number	US-9458472-B2
Application number	US-58799409-A
Country	US
Kind code	B2
Filing date	Oct 15, 2009
Priority date	Oct 15, 2008
Publication date	Oct 4, 2016
Grant date	Oct 4, 2016

Abstract

In its various embodiments, the invention provides, first, a composition comprising a vector for transfecting a cell. The vector comprises a first nucleic acid encoding an antisense agent having thereon an RNA interference target for a transcript of a gene endogenous to the cell. The vector further comprises a second nucleic acid that encodes a cell-killing agent. The second nucleic acid further comprises a sequence of nucleotides transcribable into a non-coding region of a transcript of the second nucleic acid, such that the non-coding region becomes an RNA interference target for the antisense agent. In the transfected cell, the vector operates to interfere with the expression of the cell-killing agent unless and until the vector senses certain endogenous gene signals, whereupon it releases the cell-killing agent. Second, the invention provides a method of treating a disease in a patient by killing cells responsible for the disease, the method comprising administering the vector to the patient until the disease, or a symptom thereof, is ameliorated.

First claim

The invention claimed is:

1. A composition comprising a vector for transfecting a cell, the vector comprising:
a) a first nucleic acid sequence encoding an antisense agent, said antisense agent comprising a first RNA interference target for a transcript of a gene endogenous to the cell, and
b) a second nucleic acid sequence comprising
i) a third nucleic acid sequence encoding a cell-killing agent, and
ii) a fourth nucleic acid sequence comprising a second RNA interference target that is substantially complementary to said first RNA interference target,

wherein said third nucleic acid sequence is fused to said fourth nucleic acid sequence, and wherein said antisense agent does not alter protein translation by said second RNA interference target, and wherein
1) said first RNA interference target is selected from the group consisting of GATA3 antisense sequences CGAGTCGCTGAAGAGGTTCTG (SEQ ID NO:1), CGAGTCGCTGAAGAGGTTCTGCUUCAAGAGAGCAGAACCTCTTCAGC GACTCG (SEQ ID NO:3), GTAAGTGGTATAATTGTCTGG (SEQ ID NO:6), and
GTAAGTGGTATAATTGTCTGGCUUCAAGAGAGCCAGACAATTATACCA CTTAC (SEQ ID NO:8),

2) said cell-killing agent is selected from the group consisting of BAK protein and BAX protein, and
3) said second RNA interference target is selected from the group consisting of GATA3 mRNA sequences CAGAACCTCTTCAGCGACTCG (SEQ ID NO:5) and CCAGACAATTATACCACTTAC (SEQ ID NO:10).

2. A composition comprising a vector for transfecting a cell, the vector comprising:
a) a first nucleic acid sequence encoding an antisense agent, said antisense agent comprising a first RNA interference target for a transcript of a gene that is endogenous to the cell and that is a biomarker for disease, and
b) a second nucleic acid sequence comprising
i) a third nucleic acid sequence encoding a cell-killing agent, and
ii) a fourth nucleic acid sequence comprising a second RNA interference target that is substantially complementary to said first RNA interference target,

wherein said third nucleic acid sequence is fused to said fourth nucleic acid sequence, wherein, in the presence of said biomarker, said third nucleic acid sequence and said fourth nucleic acid sequence are expressed, and wherein, in the absence of said biomarker, binding of said second RNA interference target to said second RNA interference target inhibits expression of said cell-killing agent, and wherein said antisense agent does not alter protein translation by said second RNA interference target, and wherein
1) said first RNA interference target is selected from the group consisting of GATA3 antisense sequences CGAGTCGCTGAAGAGGTTCTG (SEQ ID NO:1), CGAGTCGCTGAAGAGGTTCTGCUUCAAGAGAGCAGAACCTCTTCAGC GACTCG (SEQ ID NO:3), GTAAGTGGTATAATTGTCTGG (SEQ ID NO:6), and
GTAAGTGGTATAATTGTCTGGCUUCAAGAGAGCCAGACAATTATACCA CTTAC (SEQ ID NO:8),

2) said cell-killing agent is selected from the group consisting of BAK protein and BAX protein, and
3) said second RNA interference target is selected from the group consisting of GATA3 mRNA sequences CAGAACCTCTTCAGCGACTCG (SEQ ID NO:5) and CCAGACAATTATACCACTTAC (SEQ ID NO:10).

Assignees

• Weiss Ron
• Purnick Priscilla E M
• Dehart Caroline
• Monk Jon
• Swaminathan Aparna
• Massachusetts Inst Technology

Inventors

• Weiss Ron
• Purnick Priscilla E M
• Dehart Caroline
• Monk Jon
• Swaminathan Aparna

Classifications

• A61K48/0058

  Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct · CPC title

• A61K35/13

  Tumour cells, irrespective of tissue of origin (tumour vaccines A61K39/00) · CPC title

• C12N2840/005

  cell cycle specific · CPC title

• C12N2740/15043

  viral genome or elements thereof as genetic vector · CPC title

• C12N15/63

  Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression · CPC title