Multiple exon skipping compositions for DMD

Patent metadata

Field	Value
Publication number	US-9447417-B2
Application number	US-201514858416-A
Country	US
Kind code	B2
Filing date	Sep 18, 2015
Priority date	Oct 24, 2008
Publication date	Sep 20, 2016
Grant date	Sep 20, 2016

Abstract

Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy.

First claim

It is claimed:

1. An antisense oligonucleotide of formula (I):

or a pharmaceutically acceptable salt thereof, wherein:
Z is 18;
R is H or —C(O)CH 3 , and
each B is adenine, guanine, thymine, or cytosine, which taken together form a base sequence that is 100% complementary to 20 consecutive bases of exon 44 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of ATAATGAAAACGCCGCCATTTCTCA (SEQ ID NO:8), and wherein the antisense oligonucleotide induces exon 44 skipping.

2. A pharmaceutical composition comprising:
(a) an antisense oligonucleotide of formula (I):

or a pharmaceutically acceptable salt thereof, wherein:
Z is 18;
R is H or —C(O)CH 3 , and
each B is adenine, guanine, thymine, or cytosine, which taken together form a base sequence that is 100% complementary to 20 consecutive bases of exon 44 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of ATAATGAAAACGCCGCCATTTCTCA (SEQ ID NO:8), and wherein the antisense oligonucleotide induces exon 44 skipping; and
(b) a pharmaceutically acceptable carrier.

3. An antisense oligonucleotide of formula (I):

or a pharmaceutically acceptable salt thereof, wherein:
Z is 19;
R is H or —C(O)CH 3 , and
each B is adenine, guanine, thymine, or cytosine, which taken together form a base sequence that is 100% complementary to 21 consecutive bases of exon 44 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of ATAATGAAAACGCCGCCATTTCTCA (SEQ ID NO:8), and wherein the antisense oligonucleotide induces exon 44 skipping.

4. A pharmaceutical composition comprising:
(a) an antisense oligonucleotide of formula (I):

or a pharmaceutically acceptable salt thereof, wherein:
Z is 19;
R is H or —C(O)CH 3 , and
each B is adenine, guanine, thymine, or cytosine, which taken together form a base sequence that is 100% complementary to 21 consecutive bases of exon 44 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of ATAATGAAAACGCCGCCATTTCTCA (SEQ ID NO:8), and wherein the antisense oligonucleotide induces exon 44 skipping; and
(b) a pharmaceutically acceptable carrier.

Assignees

• Sarepta Therapeutics Inc

Inventors

• Sazani Peter
• Kole Ryszard

Classifications

• A61P21/04

  for myasthenia gravis · CPC title

• A61P21/00

  Drugs for disorders of the muscular or neuromuscular system · CPC title

• C12N2320/33

  Alteration of splicing · CPC title

• C12N2310/3233

  Morpholino-type ring · CPC title

• C12N15/113 Primary

  Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)} · CPC title