Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US-2015376615-A1 · Dec 31, 2015 · US
Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9422555B2 · US · B2
| Field | Value |
|---|---|
| Publication number | US-9422555-B2 |
| Application number | US-201514857555-A |
| Country | US |
| Kind code | B2 |
| Filing date | Sep 17, 2015 |
| Priority date | Jun 28, 2004 |
| Publication date | Aug 23, 2016 |
| Grant date | Aug 23, 2016 |
How to read this patent
A practical reading order for non-experts. Skip the full description unless you need deep technical detail.
- Title
What the patent document calls the invention.
- Abstract
A short plain-language summary of the technical disclosure.
- Assignees and inventors
Who owns or filed the patent and who is credited as inventor.
- Key dates
Filing, priority, publication, and grant dates set the timeline.
- First independent claim
The legal scope of protection — read this for what is actually claimed.
- CPC / IPC classifications
Technology tags used to group this patent with similar filings.
- Citations and related patents
Prior art links and similar publications in this corpus.
Abstract
Official abstract text for this publication.
An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202.
First claim
Opening claim text (preview).
We claim: 1. An antisense oligonucleotide of 25 bases comprising a base sequence that is 100% complementary to 25 consecutive bases of exon 45 of the human dystrophin pre-mRNA, wherein the base sequence comprises at least 12 consecutive bases of CCAAUGCCAUCCUGGAGUUCCUGUAA (SEQ ID NO: 207), in which cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′-O-methyl phosphorothioate oligoribonucleotide, and wherein the antisense oligonucleotide induces exon 45 skipping; or a pharmaceutically acceptable salt thereof. 2. An antisense oligonucleotide of 25 bases comprising a base sequence that is 100% complementary to 25 consecutive bases of exon 45 of the human dystrophin pre-mRNA, wherein the base sequence comprises at least 12 consecutive bases of CCAAUGCCAUCCUGGAGUUCCUGUAA (SEQ ID NO: 207), wherein the antisense oligonucleotide is a 2′-O-methyl phosphorothioate oligoribonucleotide, and wherein the antisense oligonucleotide induces exon 45 skipping; or a pharmaceutically acceptable salt thereof. 3. A pharmaceutical composition comprising: (a) an antisense oligonucleotide of 25 bases comprising a base sequence that is 100% complementary to 25 consecutive bases of exon 45 of the human dystrophin pre-mRNA, wherein the base sequence comprises at least 12 consecutive bases of CCAAUGCCAUCCUGGAGUUCCUGUAA (SEQ ID NO: 207), in which cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′-O-methyl phosphorothioate oligoribonucleotide, and wherein the antisense oligonucleotide induces exon 45 skipping; or a pharmaceutically acceptable salt thereof, and (b) a pharmaceutically acceptable carrier. 4. A pharmaceutical composition comprising: (a) an antisense oligonucleotide of 25 bases comprising a base sequence that is 100% complementary to 25 consecutive bases of exon 45 of the human dystrophin pre-mRNA, wherein the base sequence comprises at least 12 consecutive bases of CCAAUGCCAUCCUGGAGUUCCUGUAA (SEQ ID NO: 207), wherein the antisense oligonucleotide is a 2′-O-methyl phosphorothioate oligoribonucleotide, and wherein the antisense oligonucleotide induces exon 45 skipping; or a pharmaceutically acceptable salt thereof, and (b) a pharmaceutically acceptable carrier.
Assignees
Inventors
Classifications
Drugs for disorders of the muscular or neuromuscular system · CPC title
of the base · CPC title
Antisense · CPC title
Special therapeutic applications · CPC title
5-Methylcytosine · CPC title
Patent family
Related publications grouped by family.
External sources
Frequently asked questions
Answers are generated from the same data shown on this page.
- What does patent US9422555B2 cover?
- An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202.
- Who is the assignee on this patent?
- Univ Western Australia
- What technology area does this patent fall under?
- Primary CPC classification C12N15/113. Mapped technology areas include Chemistry & Metallurgy.
- When was this patent published?
- Publication date Tue Aug 23 2016 00:00:00 GMT+0000 (Coordinated Universal Time) (B2). Legal status and post-grant events are not shown on this page.
- What related patents are in patentsdb?
- We list 12 related publications on this page (citations in our corpus or others sharing the same primary CPC).