MRNA-sensing switchable gRNAs

Patent metadata

Field	Value
Publication number	US-9340799-B2
Application number	US-201414326340-A
Country	US
Kind code	B2
Filing date	Jul 8, 2014
Priority date	Sep 6, 2013
Publication date	May 17, 2016
Grant date	May 17, 2016

Abstract

Some aspects of this disclosure provide compositions, methods, systems, and kits for controlling the activity and/or improving the specificity of RNA-programmable endonucleases, such as Cas9. For example, provided are guide RNAs (gRNAs) that are engineered to exist in an “on” or “off” state, which control the binding and hence cleavage activity of RNA-programmable endonucleases. Some aspects of this disclosure provide mRNA-sensing gRNAs that modulate the activity of RNA-programmable endonucleases based on the presence or absence of a target mRNA.

First claim

What is claimed is:

1. A mRNA-sensing single-guide RNA (sgRNA) comprising:
(1) a domain that binds a Cas9 protein, comprising an sgRNA backbone sequence forming a first stem-loop structure; and
(2) a DNA-targeting domain, comprising
(i) a guide region comprising a sequence of at least 10 contiguous nucleotides that is 100% complementary to a target DNA;
(ii) a guide block region comprising a sequence of at least 10 contiguous nucleotides that is 100% complementary to a nucleotide sequence of the guide region (i); and
(iii) a transcript sensor region that hybridizes to a region of an mRNA transcript,

wherein the domain that binds a Cas9 protein (1) and the DNA-targeting domain (2) do not overlap, and wherein the guide region (i) and the guide block region (ii) do not overlap.

2. The mRNA-sensing sgRNA of claim 1 , wherein region (i) comprises a sequence of at least 15 contiguous nucleotides that is 100% complementary to the first region of the target DNA sequence, region (ii) comprises a sequence of at least 15 contiguous nucleotides that is 100% complementary to the nucleotide sequence of the guide region (i), and wherein the transcript sensor region comprises at least 10 nucleotides.

3. The mRNA-sensing sgRNA of claim 1 , wherein the DNA-targeting domain (2) forms a second stem-loop structure in which the stem comprises a sequence of the guide block region (ii) hybridized to part or all of the guide region (i), and the loop of the second stem-loop structure is formed by part or all of the sequence of the transcript sensor region (iii).

4. The mRNA-sensing sgRNA of claim 3 , wherein the guide block region (ii) and the transcript sensor region (iii) are both either 5′ or 3′ to the guide region (i).

5. The mRNA-sensing sgRNA of claim 3 , wherein the second stem-loop structure forms in the absence of the transcript that hybridizes to the sequence of the transcript sensor region (iii).

6. The mRNA-sensing sgRNA of claim 3 , wherein the binding of the transcript to the transcript sensor region (iii) results in the unfolding of the second stem-loop structure, or prevents the formation of the second stem-loop structure, such that the guide block region (ii) does not hybridize to the guide region (i).

7. The mRNA-sensing sgRNA of claim 5 , wherein the sgRNA is bound to a Cas9 protein, and wherein the guide region (i) hybridizes to the target DNA when the transcript sensor region (iii) binds the transcript.

8. A complex comprising a Cas9 protein and the mRNA-sensing sgRNA of claim 1 .

9. A method for site specific DNA cleavage comprising contacting a DNA with a complex comprising a Cas9 protein and the mRNA-sensing sgRNA of claim 1 , wherein the mRNA-sensing sgRNA is bound by an mRNA thereby allowing the complex to bind and cleave the DNA.

10. A vector for recombinant expression comprising a polynucleotide encoding the mRNA-sensing sgRNA of claim 1 and optionally a polynucleotide encoding a Cas9 protein.

11. An isolated cell comprising a genetic construct for expressing the mRNA-sensing sgRNA of claim 1 and optionally a Cas9 protein.

12. A kit comprising the mRNA-sensing sgRNA of claim 1 .

13. A kit comprising a polynucleotide encoding the mRNA-sensing sgRNA of claim 1 .

14. A kit comprising a vector for recombinant expression, wherein the vector comprises a polynucleotide that encodes the mRNA-sensing sgRNA of claim 1 .

15. A kit comprising a cell that comprises a genetic construct for expressing the mRNA-sensing sgRNA of claim 1 .

16. The kit of claim 12 , further comprising one or more Cas9 proteins or vectors for expressing one or more Cas9 proteins.

17. The mRNA-sensing sgRNA of claim 1 , wherein the stem loop structure of the sgRNA backbone comprises
(a) a sequence that is homologous to a tracrRNA sequence; and
(b) a sequence that is homologous to a crRNA sequence,
wherein the sequences of (a) and (b) hybridize to form the stem of the stem-loop structure, and wherein the 5′-end of the tracrRNA is connected to the 3′-end of the crRNA sequence via a polynucleotide linker that forms the loop of the stem-loop structure.

18. The mRNA-sensing sgRNA of claim 1 , wherein the sgRNA backbone sequence comprises a nucleotide sequence that is at least 90% identical to the entire length of the nucleotide sequence 5′-GUUUUAGAGCUAUGCUGAAAAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUA UC-3′ (nucleotides 53-107 of SEQ ID NO: 7) and/or at least 90% identical to the entire length of the nucleotide sequence 5′-GUUUUAGAGCUAUGCUGAAAAGCAUAGCAAGUUAAAAU-β′ (nucleotides 22-59 of SEQ ID NO: 8).

19. The mRNA-sensing sgRNA of claim 1 , wherein the stem loop of the sgRNA backbone is formed by the sequence 5′-GUUUUAGAGCUAUGCUGAAAAGCAU AGCAAGUUAAAAU-3′ (nucleotides 22-59 of SEQ ID NO: 8).

20. The mRNA-sensing sgRNA of claim 1 , wherein the guide block region (ii) is positioned 5′ of the guide region (i).

21. The mRNA-sensing sgRNA of claim 1 , wherein the transcript sensor region (iii) is positioned 5′ of the guide region (i).

22. The mRNA-sensing sgRNA of claim 1 , wherein the guide block region (ii) and the transcript sensor region (iii) are positioned 5′ of the guide region (i).

23. The mRNA-sensing sgRNA of claim 1 , wherein the guide region (i) comprises at least 15 contiguous nucleotides that are 100% complementary to the target DNA sequence.

24. The mRNA-sensing sgRNA of claim 1 , wherein the guide region (i) comprises at least 20 contiguous nucleotides that are 100% complementary to the target DNA sequence.

25. The mRNA-sensing sgRNA of claim 1 , wherein the guide region (i) comprises at least 25 contiguous nucleotides that are 100% complementary to the target DNA sequence.

26. The mRNA-sensing sgRNA of claim 24 , wherein the target DNA sequence is a genomic DNA sequence.

27. The mRNA-sensing sgRNA of claim 1 , wherein the guide region (i), the guide block region (ii) and the transcript sensor region (iii) do not overlap.

Assignees

• Harvard College

Inventors

• Liu David R
• Hu Johnny Hao

Classifications

• C12N15/63

  Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression · CPC title

• C12N15/102 Primary

  Mutagenizing nucleic acids · CPC title

• C12N2320/53

  reducing unwanted side-effects · CPC title

• C12Y301/00

  Hydrolases acting on ester bonds (3.1) · CPC title

• C12N9/22

  Ribonucleases {[RNase]; Deoxyribonucleases [DNase]} · CPC title