UNC-45A splice variants based cancer diagnostics and therapeutics

Patent metadata

Field	Value
Publication number	US-9127273-B2
Application number	US-201013144476-A
Country	US
Kind code	B2
Filing date	Jan 12, 2010
Priority date	Jan 13, 2009
Publication date	Sep 8, 2015
Grant date	Sep 8, 2015

Abstract

Methods and compositions to diagnose and treat cancers using UNC-45A splice variants are disclosed. Expression of a human UNC-45A929 splice variant that is shorter than UNC-45A944 splice variant is increased in cancer cells including metastatic cancers. siRNA to inhibit or downregulate UNC-45A splice variants in cancers are disclosed.

First claim

The invention claimed is:

1. A short interfering RNA (siRNA) or a short hairpin RNA (shRNA) molecule for targeting human UNC-45A splice variant in a cell that is substantially complementary to a nucleotide sequence of TGGCCGTCACTACCCTGGTTTCTTT (SEQ ID NO:5) or GGACAGAGGTGGTAGTGAACT (SEQ ID NO:6) of the UNC-45A929 splice variant, or a nucleotide sequence of GGTCCAGGGACCCCCGAGCCCCG (SEQ ID NO:7) or GTGAGTGGTCCAGGGACCCC (SEQ ID NO:8) of UNC-45A944.

2. The RNA of claim 1 , wherein the siRNA comprises one or more modified nucleotides.

3. The RNA of claim 1 , wherein the shRNA is expressed from a vector.

4. A method of reducing the proliferation of a cancer cell, the method comprising contacting the cancer cell with an RNAi agent of claim 1 that specifically downregulates the expression of UNC-45A splice variants.

5. The method of claim 4 , wherein the RNAi agent is a siRNA molecule that specifically targets UNC-45A929 splice variant.

6. The method of claim 4 , wherein the RNAi agent is a shRNA molecule.

7. The method of claim 4 , wherein the cancer cell is selected from the group consisting of breast cancer, cervical cancer and colon cancer.

8. The method of claim 4 , wherein the cancer cell is a metastatic breast cancer cell.

9. The method of claim 4 , wherein the RNAi agent is a siRNA molecule that targets TGGCCGTCACTACCCTGGTTTCTTT (SEQ ID NO:5) or GGACAGAGGTGGTAGTGAACT (SEQ ID NO:6) of the UNC-45A929 splice variant.

10. A short interfering RNA (siRNA) or a short hairpin RNA (shRNA) molecule for targeting human UNC-45A splice variant in a cell that is fully complementary to nucleotide sequence of TGGCCGTCACTACCCTGGTTTCTTT (SEQ ID NO:5) or GGACAGAGGTGGTAGTGAACT (SEQ ID NO:6) of the UNC-45A929 splice variant, or nucleotide sequence of GGTCCAGGGACCCCCGAGCCCCG (SEQ ID NO:7) or GTGAGTGGTCCAGGGACCCC (SEQ ID NO:8) of UNC-45A944.

Assignees

• Epstein Henry Fredric
• Guo Wei
• Chen Daisi
• Singh Ram
• Univ Texas

Inventors

• Epstein Henry Fredric
• Guo Wei
• Chen Daisi
• Singh Ram

Classifications

• G01N33/575

  for cancer · CPC title

• C07K14/47

  from mammals · CPC title

• C12N2310/14

  interfering nucleic acids [NA] · CPC title

• C12N15/113 Primary

  Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)} · CPC title

• G01N33/574

  Physics · mapped topic