Compositions and methods for targeted delivery to cells
US-2024390271-A1 · Nov 28, 2024 · US
Modulation of axon degeneration
US9101645B2 · US · B2
| Field | Value |
|---|---|
| Publication number | US-9101645-B2 |
| Application number | US-200913125333-A |
| Country | US |
| Kind code | B2 |
| Filing date | Oct 22, 2009 |
| Priority date | Oct 22, 2008 |
| Publication date | Aug 11, 2015 |
| Grant date | Aug 11, 2015 |
How to read this patent
A practical reading order for non-experts. Skip the full description unless you need deep technical detail.
- Title
What the patent document calls the invention.
- Abstract
A short plain-language summary of the technical disclosure.
- Assignees and inventors
Who owns or filed the patent and who is credited as inventor.
- Key dates
Filing, priority, publication, and grant dates set the timeline.
- First independent claim
The legal scope of protection — read this for what is actually claimed.
- CPC / IPC classifications
Technology tags used to group this patent with similar filings.
- Citations and related patents
Prior art links and similar publications in this corpus.
Abstract
Official abstract text for this publication.
The invention relates generally to treatment of neurological disorders and nervous system injuries. The invention specifically provides methods of using modulators of particular target proteins to modulate degeneration of neurons or portions thereof, such as axons.
First claim
Opening claim text (preview).
What is claimed is: 1. A method for inhibiting degeneration of an axon of a central nervous system neuron, wherein the method comprises administering to the neuron, or a portion thereof, a short interfering RNA (siRNA) that is specific for dual leucine zipper-bearing kinase (DLK) and comprises a nucleic acid sequence selected from the group consisting of GCACTGAATTGGACAACTCTT (SEQ ID NO: 1), GAGTTGTCCAATTCAGTGCTT (SEQ ID NO: 2), GGACATCGCCTCCGCTGATTT (SEQ ID NO: 3), ATCAGCGGAGGCGAT…
Assignees
Inventors
Classifications
Patent family
Related publications grouped by family.
External sources
Next steps
Free tools are coming soon. Tell us what you want to track and we'll notify you.
Frequently asked questions
Answers are generated from the same data shown on this page.
- What does patent US9101645B2 cover?
- The invention relates generally to treatment of neurological disorders and nervous system injuries. The invention specifically provides methods of using modulators of particular target proteins to modulate degeneration of neurons or portions thereof, such as axons.
- Who is the assignee on this patent?
- Watts Ryan, Chen Mark, Lewcock Joseph Wesley, and 3 more
- What technology area does this patent fall under?
- Primary CPC classification A61K31/7105. Mapped technology areas include Human Necessities.
- When was this patent published?
- Publication date Tue Aug 11 2015 00:00:00 GMT+0000 (Coordinated Universal Time) (B2). Legal status and post-grant events are not shown on this page.
- What related patents are in patentsdb?
- We list 8 related publications on this page (citations in our corpus or others sharing the same primary CPC).