Method for breeding improved variety of forage sorghum-bacillus megaterium symbiont

Patent metadata

Field	Value
Publication number	US-2025081909-A1
Application number	US-202318730543-A
Country	US
Kind code	A1
Filing date	Oct 16, 2023
Priority date	Oct 19, 2022
Publication date	Mar 13, 2025
Grant date	—

Abstract

A method for breeding an improved variety of a forage sorghum- Bacillus megaterium symbiont, and a CAPS marker for rapidly identifying Bacillus megaterium BM18-2. The method includes: when a stigma of a female parent is exerted for 2-3 d, spraying a Bacillus megaterium solution to the stigma, then pollinating same with pollens from anthers of a male parent after the anthers are exerted for 2-5 d, and harvesting mature seeds. The CAPS marker mainly includes a primer pair designed for an SNP site and endonuclease BspT104I, and upstream and downstream primers are respectively SEQ ID Nos: 1-2. The first method for breeding improved variety of forage sorghum containing endophytic Bacillus megaterium . Produced seeds can significantly increase biomass, crude protein, soluble sugar content and roughage grading index (GI) of plants grown in soil with a salt content ≤8‰; and the CAPS marker can realize rapid qualitative identification of Bacillus megaterium BM18-2.

First claim

1 . A method for breeding an improved variety of a forage sorghum- Bacillus megaterium symbiont, comprising the following steps: when a stigma of a female parent is exerted for 2-3 d, spraying a Bacillus megaterium solution to the stigma, then pollinating same with pollens from anthers of a male parent after the anthers are exerted for 2-5 d, and harvesting mature seeds.

2 . A method for breeding an improved variety of a forage sorghum- Bacillus megaterium symbiont according to claim 1 , wherein the Bacillus megaterium is Bacillus megaterium BM18-2.

3 . The method for breeding an improved variety of a forage sorghum- Bacillus megaterium symbiont according to claim 1 , wherein the female parent is a Sorghum sudanense - Sorghum propinquum hybrid.

4 . The method for breeding an improved variety of a forage sorghum- Bacillus megaterium symbiont according to claim 1 , wherein the male parent is sweet sorghum.

5 . The seeds obtained by the method for breeding an improved variety of a forage sorghum- Bacillus megaterium symbiont according to claim 1 .

6 . A method for saline soil improvement comprising performing the method for breeding an improved variety of a forage sorghum- Bacillus megaterium symbiont according to claim 1 , and providing the seeds obtained by the method for breeding an improved variety of a forage sorghum- Bacillus megaterium symbiont for saline soil improvement.

7 . A method comprising breeding an endophytic bacterial symbiont using Bacillus megaterium , or a microbial agent containing the Bacillus megaterium , or a culture containing the Bacillus megaterium , or a microbial fertilizer containing the Bacillus megaterium.

8 . A CAPS marker for rapidly identifying Bacillus megaterium BM18-2, mainly comprising a primer pair designed for an SNP site and endonuclease BspT104I, wherein
an upstream primer and a downstream primer of the primer pair are respectively as follows: the upstream primer F: GTATTACTTGAAGGCAATCGTCCAGC shown in SEQ ID No: 1; and the downstream primer R: AGCGTCTTCAGCAATGATGACTTCC shown in SEQ ID No: 2.

9 . A method comprising
identifying Bacillus megaterium BM18-2 and/or determining whether a sample to be detected contains the Bacillus megaterium BM18-2 using the CAPS marker according to claim 8 .

10 . A kit for rapidly identifying Bacillus megaterium BM18-2, containing the CAPS marker according to claim 8 .

11 . A method comprising:
preparing a kit for detecting Bacillus megaterium BM18-2, the kit including the CAPS marker according to claim 8 .

12 . A method comprising:
assisting in breeding an endophytic bacterial symbiont using the CAPS marker according to claim 8 .

Assignees

• Jiangsu Acad Agricultural Sci

Inventors

• Zhong Xiaoxian
• Mao Zhengfeng
• Xue Wentao
• Liu Zhiwei
• Qian Chen
• Wu Juanzi

Classifications

• A01N63/22

  Bacillus · CPC title

• C12Q2600/156

  Polymorphic or mutational markers · CPC title

• C12Q2600/13

  Plant traits · CPC title

• C12Q1/6895

  for plants, fungi or algae · CPC title

• A01H5/10

  Seeds · CPC title