Gamma herpesvirus circular rna

Patent metadata

Field	Value
Publication number	US-2023183825-A1
Application number	US-202218049378-A
Country	US
Kind code	A1
Filing date	Oct 25, 2022
Priority date	Jun 1, 2018
Publication date	Jun 15, 2023
Grant date	—

Abstract

In an embodiment, the invention provides a method and reagents for detection of γ-herpesvirus circRNA. In another embodiment, the invention provides a method and reagents for detection of EBV circRNA. In still another embodiment, the invention provides a method and reagents for detection of KSHV circRNA. The method can be expanded to other herpesviruses and even non-herpesviruses that generate circRNA upon cellular infection.

First claim

1 . An oligonucleotide that hybridizes, under high stringency conditions, to a sequence selected from the sequences set forth in the Examples set forth herein entitled “EXAMPLE 1—Epstein-Barr Virus (EBV) circRNA” and “EXAMPLE 2—Kaposi's Sarcoma-Associated Herpesvirus (KSHV) circRNA,” wherein said oligonucleotide comprises between 10 and 30 nucleic acids.

2 . An oligonucleotide that hybridizes to the BART small junction (SJ) sequence (TCGACGGGCAAGGTCCGGCGTGTC (SEQ ID NO:7)), the BART large junction (LJ) sequence (TCGACGGGCAAGATGCCATTGGGC (SEQ ID NO:8)), or the RF junction sequence (CATCTACCTCAGCCCCCGCGCCCC (SEQ ID NO:13).

3 . The oligonucleotide of claim 2 , which comprises the following sequence: GGGGCGCGGGGGCTGAGGUAGAUG (SEQ ID NO:14), wherein each of the nucleotides at positions 1-6 and 19-24 of SEQ ID NO: 14 contains 2′-O-methylated ribose and each contiguous nucleotide of SEQ ID NO: 14 is connected by a phosphorothioate bond.

4 . The oligonucleotide of claim 2 , which comprises the following sequence: GACACGCCGGACCTTGCCCGUCGA (SEQ ID NO:9), wherein each of the nucleotides at positions 1-6 and 19-24 of SEQ ID NO: 9 contains 2′-O-methylated ribose and each contiguous nucleotide of SEQ ID NO: 9 is connected by a phosphorothioate bond.

5 . The oligonucleotide of claim 2 , which comprises the following sequence: GCCCAATGGCATCTTGCCCGUCGA (SEQ ID NO:11), wherein each of the nucleotides at positions 1-6 and 19-24 of SEQ ID NO: 11 contains 2′-O-methylated ribose and each contiguous nucleotide of SEQ ID NO: 11 is connected by a phosphorothioate bond.

6 . A method of treating a condition associated with γ-herpesvirus infection in a mammal, the method comprising administering to the mammal the oligonucleotide of claim 1 to the mammal in an amount effective to treat or prevent the condition in the mammal.

7 . The method according to claim 6 , wherein the γ-herpesvirus infection is a KSHV infection.

8 . The method according to claim 6 , wherein the condition is Kaposi's Sarcoma or lymphoma.

9 . The method according to claim 6 , wherein the γ-herpesvirus infection is an EBV infection.

10 . The method according to claim 6 , wherein the condition is infectious mononucleosis, lymphoma, or nasopharyngeal cancer.

11 . A method of treating a condition associated with γ-herpesvirus infection in a mammal, the method comprising administering to the mammal the oligonucleotide of claim 3 to the mammal in an amount effective to treat or prevent the condition in the mammal.

12 . A method of treating a condition associated with γ-herpesvirus infection in a mammal, the method comprising administering to the mammal the oligonucleotide of claim 4 to the mammal in an amount effective to treat or prevent the condition in the mammal.

13 . A method of treating a condition associated with γ-herpesvirus infection in a mammal, the method comprising administering to the mammal the oligonucleotide of claim 5 to the mammal in an amount effective to treat or prevent the condition in the mammal.

14 . The method according to claim 11 , wherein the γ-herpesvirus infection is a KSHV infection.

15 . The method according to claim 11 , wherein the condition is Kaposi's Sarcoma or lymphoma.

16 . A composition comprising the oligonucleotide of claim 2 and a pharmaceutically-acceptable carrier.

17 . A composition comprising the oligonucleotide of claim 3 and a pharmaceutically-acceptable carrier.

18 . A composition comprising the oligonucleotide of claim 4 and a pharmaceutically-acceptable carrier.

19 . A composition comprising the oligonucleotide of claim 1 and a pharmaceutically-acceptable carrier.

20 . A vector comprising a circRNA and a gene of interest expressed under the control of a heterologous promoter.

Assignees

• Univ Pittsburgh Commonwealth Sys Higher Education

Inventors

• Moore Patrick S
• Toptan Tuna
• Chang Yuan

Classifications

• C12N2310/321

  2'-O-R Modification · CPC title

• C12N2310/11

  Antisense · CPC title

• C12N2310/315

  Phosphorothioates · CPC title

• C12N2310/341

  Gapmers, i.e. of the type ===---=== · CPC title

• C12Q1/705 Primary

  for herpetoviridae, e.g. herpes simplex, varicella zoster · CPC title