Nucleic acid-controlled catalytic rnas for trigger-responsive regulation
US-2024425855-A1 · Dec 26, 2024 · US
US2021130850A1 · US · A1
| Field | Value |
|---|---|
| Publication number | US-2021130850-A1 |
| Application number | US-202017099503-A |
| Country | US |
| Kind code | A1 |
| Filing date | Nov 16, 2020 |
| Priority date | Mar 15, 2013 |
| Publication date | May 6, 2021 |
| Grant date | — |
A practical reading order for non-experts. Skip the full description unless you need deep technical detail.
What the patent document calls the invention.
A short plain-language summary of the technical disclosure.
Who owns or filed the patent and who is credited as inventor.
Filing, priority, publication, and grant dates set the timeline.
The legal scope of protection — read this for what is actually claimed.
Technology tags used to group this patent with similar filings.
Prior art links and similar publications in this corpus.
Official abstract text for this publication.
Methods for increasing specificity of RNA-guided genome editing, e.g., editing using CRISPR/Cas9 systems.
Opening claim text (preview).
1 .- 30 . (canceled) 31 . A method of inducing a single or double-stranded break in a target region of a double-stranded DNA molecule the method comprising expressing in or introducing into the cell: a Cas9 nuclease or nickase; a tracrRNA; and a crRNA that includes one or more nucleotides that are modified, wherein one or more of the nucleotides in the target complementarity region is modified, and wherein the crRNA includes a sequence of 17-20 nucleotides that are complementary to the target sequence, preferably the target sequence immediately 5′ of a protospacer adjacent motif (PAM). 32 . The method of claim 31 , wherein the one or more nucleotides that are modified are selected from 2′-O-4′-C methylene bridge, 5′-methylcytidine, or 2′-O-methyl-pseudouridine. 33 . The method of claim 31 , wherein the one or more nucleotides that are modified and wherein the ribose phosphate backbone has been replaced by a polyamide chain. 34 . The method of claim 31 , wherein the crRNA consists of the sequence: (X17 20)GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO:4); (X17 20)GUUUUAGAGCUA (SEQ ID NO:5); (X17 20)GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO:6); or (X17 20)GUUUUAGAGCUAUGCU (SEQ ID NO:7). 35 . The method of claim 34 , wherein X17 20 is not identical to a sequence that naturally occurs adjacent to the rest of the RNA. 36 . The method of claim 34 , wherein the crRNA includes one or more U at the 3′ end of the molecule. 37 . The method of claim 34 , wherein the crRNA includes one or more additional nucleotides at the 5′ end of the RNA molecule that is not complementary to the target sequence. 38 . The method of claim 31 , wherein the tracrRNA comprises the sequence of: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAAGUGGCACCGAGTCGGUGCUUUU (SEQ ID NO:15) or an active portion thereof, UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC GAGUCGGUGC (SEQ ID NO:16) or an active portion thereof, AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGG CACCGAGUCGGUGC (SEQ ID NO:17) or an active portion thereof, GGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:42) or an active portion thereof, UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC GAGUCGGUGC (SEQ ID NO:16) or an active portion thereof, CAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAA AAGUGGCACCGAGUCGGUGC (SEQ ID NO:43) or an active portion thereof; AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGG CACCGAGUCGGUGC (SEQ ID NO:17) or an active portion thereof; UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUG (SEQ ID NO:44) or an active portion thereof; UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA (SEQ ID NO:45) or an active portion thereof; or UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO:46) or an active portion thereof. 39 . The method of claim 31 , wherein the crRNA has the sequence of: (SEQ ID NO: 6) (X17-20)GUUUUAGAGCUAUGCUGUUUUG, and the tracrRNA has the sequence of: GGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACU UGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:8) or an active portion thereof. 40 . The method of claim 31 , wherein the crRNA has the sequence of: (X17-20)GUUUUAGAGCUA (SEQ ID NO:5), and the tracrRNA has the sequence of: UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC GAGUCGGUGC (SEQ ID NO:16) or an active portion thereof. 41 . The method of claim 31 , wherein the crRNA has the sequence of: (X17-20) GUUUUAGAGCUAUGCU (SEQ ID NO:7), and the tracrRNA has the sequence of: AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC GAGUCGGUGC (SEQ ID NO:17) or an active portion thereof.
Methyltransferases (2.1.1) · CPC title
involving clustered regularly interspaced short palindromic repeats [CRISPR] · CPC title
Hydrolases acting on ester bonds (3.1) · CPC title
Ribonucleases {[RNase]; Deoxyribonucleases [DNase]} · CPC title
Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)} · CPC title
Related publications grouped by family.
Answers are generated from the same data shown on this page.