Compositions and methods for treating acute myeloid leukemia

US2020323898A1 · US · A1

Patent metadata
FieldValue
Publication numberUS-2020323898-A1
Application numberUS-201816767280-A
CountryUS
Kind codeA1
Filing dateNov 27, 2018
Priority dateNov 28, 2017
Publication dateOct 15, 2020
Grant date

How to read this patent

A practical reading order for non-experts. Skip the full description unless you need deep technical detail.

  1. Title

    What the patent document calls the invention.

  2. Abstract

    A short plain-language summary of the technical disclosure.

  3. Assignees and inventors

    Who owns or filed the patent and who is credited as inventor.

  4. Key dates

    Filing, priority, publication, and grant dates set the timeline.

  5. First independent claim

    The legal scope of protection — read this for what is actually claimed.

  6. CPC / IPC classifications

    Technology tags used to group this patent with similar filings.

  7. Citations and related patents

    Prior art links and similar publications in this corpus.

Abstract

Official abstract text for this publication.

The present disclosure relates generally to methods for ameliorating or treating acute myeloid leukemia (AML). In particular, the present technology relates to administering a therapeutically effective amount of one or more compositions that inhibit the vitamin B6 pathway to a subject diagnosed with, or at risk for AML.

First claim

Opening claim text (preview).

1 . A method for treating or preventing AML in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one inhibitor of Vitamin B6 pathway selected from the group consisting of isoniazid, aftin-4, DFMO, gingkotoxin, aminooxyacetic acid, and myriocin, or a therapeutically effective amount of at least one sgRNA or shRNA that targets one or more genes selected from the group consisting of PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, and SPTLC2. 2 . (canceled) 3 . The method of claim 1 wherein the at least one sgRNA or shRNA comprises a nucleic acid sequence selected from the group consisting of: (SEQ ID NO: 1) 5′ TGGCTACGTGGGTAACAGAG 3′ (Pdxk sg-1), (SEQ ID NO: 2) 5′ ATCCAGAGCCATGTTGTCCG 3′ (Pdxk sg-2), (SEQ ID NO: 3) 5′ GTGCAGTTTTCAAACCACAC 3′ (Pdxk sg-3), (SEQ ID NO: 4) 5′ GCTTGGGGTGCCTGCAGAGA 3′ (Odc1-a106), (SEQ ID NO: 5) 5′ TGCTGTTGACAGTGAGCGCCAAGGTGAACGATGTCAATAATAGT GAAGCCACAGATGTATTATTGACATCGTTCACCTTGATGCCTACTGC CTCGGA 3′ (Pdxk.307), (SEQ ID NO: 6) TGCTGTTGACAGTGAGCGCCAGGTTCAATGTGAGGTTACATAGTGAA GCCACAGATGTATGTAACCTCACATTGAACCTGATGCCTACTGCCTC GGA 3′ (Pdxk.3259), (SEQ ID NO: 7) 5′ ACGCCCAGGATGGGATCTGG 3′ (Got2.a41), (SEQ ID NO: 8) 5′ AAAGAATACCTGCCCATTGG 3′ (Got2.a99), (SEQ ID NO: 9) 5′ GACTGGAGCCTTAAGGGTCG 3′ (Got2.a140), (SEQ ID NO: 10) 5′ ATACAGAGCCACGTCATCCG 3′ (hPdxk-aa15), (SEQ ID NO: 11) 5′ CGGCTACGTGGGCAACCGGG 3′ (hPdxk-aa22), (SEQ ID NO: 12) 5′ GCCTACCGTACACCAGCCTG 3′ (hPdxk-aa105), (SEQ ID NO: 13) 5′ GTCCCCAGTGCCCACAAAGA 3′ (hPDXK-aa230), (SEQ ID NO: 14) 5′ AATGGCTTTAGTGCAAGAAT 3′ (Azin1-a100), (SEQ ID NO: 15) 5′ GAACTACTCCGTTGGCCTGT 3′ (Azin1-a14), (SEQ ID NO: 16) 5′ GCCAAGATCTCAAGCACGGC 3′ (Azin1-a76), (SEQ ID NO: 17) 5′ ATATTGACGTCATTGGTGTG 3′ (Odc1-a194), (SEQ ID NO: 18) 5′ AGGCAGCAGCGTCTTCCGCA 3′ (ALAS1 sg-1), (SEQ ID NO: 19) 5′ CACCGTTTTAAAAACTCGGT 3′ (ALAS2 sg-2), (SEQ ID NO: 20) 5′ CTCGGGATAAGAATGGGCAT 3′ (ALAS1 sg-3), (SEQ ID NO: 21) 5′ TGCGTAAAAGGGAGTGACGC 3′ (Odc1-a62), (SEQ ID NO: 22) 5′ GCTGGCCAACCCTCGAGTTA 3′ (SPTLC1 sg-1), (SEQ ID NO: 23) 5′ GATGGTGCAGGCGCTGTACG 3′ (SPTLC1 sg-2), (SEQ ID NO: 24) 5′ TCAACTACAACATCGTGTCC 3′ (SPTLC1 sg-3), (SEQ ID NO: 25) 5′ GCTCCAGGCACACTACAGAT 3′ (SPTLC2 sg-1), (SEQ ID NO: 26) 5′ GAACGGCTGCGTCAAGAACG 3′ (SPTLC2 sg-2), (SEQ ID NO: 27) 5′ AATCTCGAAGATATCCAAAG 3′ (SPTLC2 sg-3), (SEQ ID NO: 28) 5′ GGTGTGTGGTTTCCCCAGGT 3′ (hGOT2.a162), (SEQ ID NO: 29) 5′ GATGGGTGTGTGGTTTCCCC 3′ (hGOT2.a163), (SEQ ID NO: 30) 5′ GGACGCGGGTCCACTCCCGT 3′ (hGOT2.a218), (SEQ ID NO: 31) 5′ TGGACCCGCGTCCGGAACAG 3′ (hGOT2.a224), (SEQ ID NO: 39) 5′ ACGATGAACATGTTAGACAT 3′ (hAZIN1-a233), (SEQ ID NO: 40) 5′ CTATGTTTATGAACATACCC 3′ (hAZIN1-a33), (SEQ ID NO: 41) 5′ TATCTGCTTGATATTGGCGG 3′ (hODC1-a235), (SEQ ID NO: 42) 5′ CAACGCTGGGTTGATTACGC 3′ (hODC1-a254), (SEQ ID NO: 982) 5′ GGAGGTCCTGGGGAACGTAC 3′ (Pdxk sg-4), (SEQ ID NO: 983) 5′ CATGGCAGCGAAGAGGTCCC 3′ (Pdxk sg-5), (SEQ ID NO: 984) 5′ AGCTGTCTTCGTGGGCACCG 3′ (Pdxk sg-6), (SEQ ID NO: 985) 5′ TGTAACCTCACATTGAACCTGA 3′, (SEQ ID NO: 986)

Assignees

Inventors

Classifications

  • of the blood, e.g. leukaemia · CPC title

  • DNA or RNA fragments; Modified forms thereof (DNA or RNA not used in recombinant technology, C07H21/00); {Non-coding nucleic acids having a biological activity} · CPC title

  • Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor (mutants or genetically engineered microorganisms, per se C12N1/00, C12N5/00, C12N7/00; new plants per se A01H; plant reproduction by tissue culture techniques A01H4/00; new animals per se A01K67/00; use of medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases, gene therapy A61K48/00) · CPC title

  • Recombinant DNA-technology · CPC title

  • Mouth and digestive tract, i.e. intraoral and peroral administration · CPC title

Patent family

Related publications grouped by family.

External sources

Frequently asked questions

Answers are generated from the same data shown on this page.

What does patent US2020323898A1 cover?
The present disclosure relates generally to methods for ameliorating or treating acute myeloid leukemia (AML). In particular, the present technology relates to administering a therapeutically effective amount of one or more compositions that inhibit the vitamin B6 pathway to a subject diagnosed with, or at risk for AML.
Who is the assignee on this patent?
Memorial Sloan Kettering Cancer Center, Cold Spring Harbor Laboratory
What technology area does this patent fall under?
Primary CPC classification C12N15/1137. Mapped technology areas include Chemistry & Metallurgy.
When was this patent published?
Publication date Thu Oct 15 2020 00:00:00 GMT+0000 (Coordinated Universal Time) (A1). Legal status and post-grant events are not shown on this page.
What related patents are in patentsdb?
We list 8 related publications on this page (citations in our corpus or others sharing the same primary CPC).