Treatment of Liver Diseases With Cell Death Inducing DFFA Like Effector B (CIDEB) Inhibitors
US-2024376471-A1 · Nov 14, 2024 · US
US2020323898A1 · US · A1
| Field | Value |
|---|---|
| Publication number | US-2020323898-A1 |
| Application number | US-201816767280-A |
| Country | US |
| Kind code | A1 |
| Filing date | Nov 27, 2018 |
| Priority date | Nov 28, 2017 |
| Publication date | Oct 15, 2020 |
| Grant date | — |
A practical reading order for non-experts. Skip the full description unless you need deep technical detail.
What the patent document calls the invention.
A short plain-language summary of the technical disclosure.
Who owns or filed the patent and who is credited as inventor.
Filing, priority, publication, and grant dates set the timeline.
The legal scope of protection — read this for what is actually claimed.
Technology tags used to group this patent with similar filings.
Prior art links and similar publications in this corpus.
Official abstract text for this publication.
The present disclosure relates generally to methods for ameliorating or treating acute myeloid leukemia (AML). In particular, the present technology relates to administering a therapeutically effective amount of one or more compositions that inhibit the vitamin B6 pathway to a subject diagnosed with, or at risk for AML.
Opening claim text (preview).
1 . A method for treating or preventing AML in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one inhibitor of Vitamin B6 pathway selected from the group consisting of isoniazid, aftin-4, DFMO, gingkotoxin, aminooxyacetic acid, and myriocin, or a therapeutically effective amount of at least one sgRNA or shRNA that targets one or more genes selected from the group consisting of PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, and SPTLC2. 2 . (canceled) 3 . The method of claim 1 wherein the at least one sgRNA or shRNA comprises a nucleic acid sequence selected from the group consisting of: (SEQ ID NO: 1) 5′ TGGCTACGTGGGTAACAGAG 3′ (Pdxk sg-1), (SEQ ID NO: 2) 5′ ATCCAGAGCCATGTTGTCCG 3′ (Pdxk sg-2), (SEQ ID NO: 3) 5′ GTGCAGTTTTCAAACCACAC 3′ (Pdxk sg-3), (SEQ ID NO: 4) 5′ GCTTGGGGTGCCTGCAGAGA 3′ (Odc1-a106), (SEQ ID NO: 5) 5′ TGCTGTTGACAGTGAGCGCCAAGGTGAACGATGTCAATAATAGT GAAGCCACAGATGTATTATTGACATCGTTCACCTTGATGCCTACTGC CTCGGA 3′ (Pdxk.307), (SEQ ID NO: 6) TGCTGTTGACAGTGAGCGCCAGGTTCAATGTGAGGTTACATAGTGAA GCCACAGATGTATGTAACCTCACATTGAACCTGATGCCTACTGCCTC GGA 3′ (Pdxk.3259), (SEQ ID NO: 7) 5′ ACGCCCAGGATGGGATCTGG 3′ (Got2.a41), (SEQ ID NO: 8) 5′ AAAGAATACCTGCCCATTGG 3′ (Got2.a99), (SEQ ID NO: 9) 5′ GACTGGAGCCTTAAGGGTCG 3′ (Got2.a140), (SEQ ID NO: 10) 5′ ATACAGAGCCACGTCATCCG 3′ (hPdxk-aa15), (SEQ ID NO: 11) 5′ CGGCTACGTGGGCAACCGGG 3′ (hPdxk-aa22), (SEQ ID NO: 12) 5′ GCCTACCGTACACCAGCCTG 3′ (hPdxk-aa105), (SEQ ID NO: 13) 5′ GTCCCCAGTGCCCACAAAGA 3′ (hPDXK-aa230), (SEQ ID NO: 14) 5′ AATGGCTTTAGTGCAAGAAT 3′ (Azin1-a100), (SEQ ID NO: 15) 5′ GAACTACTCCGTTGGCCTGT 3′ (Azin1-a14), (SEQ ID NO: 16) 5′ GCCAAGATCTCAAGCACGGC 3′ (Azin1-a76), (SEQ ID NO: 17) 5′ ATATTGACGTCATTGGTGTG 3′ (Odc1-a194), (SEQ ID NO: 18) 5′ AGGCAGCAGCGTCTTCCGCA 3′ (ALAS1 sg-1), (SEQ ID NO: 19) 5′ CACCGTTTTAAAAACTCGGT 3′ (ALAS2 sg-2), (SEQ ID NO: 20) 5′ CTCGGGATAAGAATGGGCAT 3′ (ALAS1 sg-3), (SEQ ID NO: 21) 5′ TGCGTAAAAGGGAGTGACGC 3′ (Odc1-a62), (SEQ ID NO: 22) 5′ GCTGGCCAACCCTCGAGTTA 3′ (SPTLC1 sg-1), (SEQ ID NO: 23) 5′ GATGGTGCAGGCGCTGTACG 3′ (SPTLC1 sg-2), (SEQ ID NO: 24) 5′ TCAACTACAACATCGTGTCC 3′ (SPTLC1 sg-3), (SEQ ID NO: 25) 5′ GCTCCAGGCACACTACAGAT 3′ (SPTLC2 sg-1), (SEQ ID NO: 26) 5′ GAACGGCTGCGTCAAGAACG 3′ (SPTLC2 sg-2), (SEQ ID NO: 27) 5′ AATCTCGAAGATATCCAAAG 3′ (SPTLC2 sg-3), (SEQ ID NO: 28) 5′ GGTGTGTGGTTTCCCCAGGT 3′ (hGOT2.a162), (SEQ ID NO: 29) 5′ GATGGGTGTGTGGTTTCCCC 3′ (hGOT2.a163), (SEQ ID NO: 30) 5′ GGACGCGGGTCCACTCCCGT 3′ (hGOT2.a218), (SEQ ID NO: 31) 5′ TGGACCCGCGTCCGGAACAG 3′ (hGOT2.a224), (SEQ ID NO: 39) 5′ ACGATGAACATGTTAGACAT 3′ (hAZIN1-a233), (SEQ ID NO: 40) 5′ CTATGTTTATGAACATACCC 3′ (hAZIN1-a33), (SEQ ID NO: 41) 5′ TATCTGCTTGATATTGGCGG 3′ (hODC1-a235), (SEQ ID NO: 42) 5′ CAACGCTGGGTTGATTACGC 3′ (hODC1-a254), (SEQ ID NO: 982) 5′ GGAGGTCCTGGGGAACGTAC 3′ (Pdxk sg-4), (SEQ ID NO: 983) 5′ CATGGCAGCGAAGAGGTCCC 3′ (Pdxk sg-5), (SEQ ID NO: 984) 5′ AGCTGTCTTCGTGGGCACCG 3′ (Pdxk sg-6), (SEQ ID NO: 985) 5′ TGTAACCTCACATTGAACCTGA 3′, (SEQ ID NO: 986)
of the blood, e.g. leukaemia · CPC title
DNA or RNA fragments; Modified forms thereof (DNA or RNA not used in recombinant technology, C07H21/00); {Non-coding nucleic acids having a biological activity} · CPC title
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor (mutants or genetically engineered microorganisms, per se C12N1/00, C12N5/00, C12N7/00; new plants per se A01H; plant reproduction by tissue culture techniques A01H4/00; new animals per se A01K67/00; use of medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases, gene therapy A61K48/00) · CPC title
Recombinant DNA-technology · CPC title
Mouth and digestive tract, i.e. intraoral and peroral administration · CPC title
Related publications grouped by family.
Answers are generated from the same data shown on this page.