Second strand direct

Patent metadata

Field	Value
Publication number	US-2020071694-A1
Application number	US-201916687411-A
Country	US
Kind code	A1
Filing date	Nov 18, 2019
Priority date	Aug 5, 2016
Publication date	Mar 5, 2020
Grant date	—

Abstract

Methods and compositions are provided herein for preparing high-throughput cDNA sequencing libraries.

First claim

What is claimed is:

1 . A method for tagging a cDNA polynucleotide, the method comprising:
providing a double-stranded mRNA:cDNA hybrid comprising a first strand cDNA polynucleotide having a 5′ end and a 3′ end and hybridized to a complementary mRNA having a 5′ end and a 3′ end, wherein the 5′ end of the first strand cDNA polynucleotide comprises a first adapter sequence or complement thereof; synthesizing one or more second strand cDNA polynucleotides that are complementary to and hybridized to the first strand cDNA polynucleotide, wherein synthesizing comprises:
i) contacting the mRNA:cDNA hybrid with an enzyme comprising RNase H activity, thereby producing mRNA fragments hybridized to the first strand cDNA, and
ii) contacting the mRNA fragments with a DNA polymerase, thereby extending the mRNA fragments in a template-directed polymerase reaction, wherein the template is the first strand cDNA polynucleotide and forming a double-stranded cDNA polynucleotide;
optionally contacting the one or more second strand cDNA polynucleotides with a DNA ligase; contacting the double-stranded cDNA polynucleotide with an adapter-loaded tagmentase, thereby forming a reaction mixture comprising a tagged double-stranded cDNA polynucleotide comprising a first end and a second end, wherein the first end comprises the first adapter sequence and complement thereof, and the second end comprises a second adapter sequence and complement thereof, wherein the 5′ end of the mRNA is single stranded; or wherein the 5′ end of the mRNA comprises a DNA:RNA hybrid, and wherein the method comprises amplifying the tagged double-stranded cDNA in a reaction mixture comprising a first amplification primer that hybridizes to the first end and a second and third amplification primer, wherein the second or third amplification primer hybridizes to the second end; or wherein the contacting the double-stranded cDNA polynucleotide with the adapter-loaded tagmentase is performed in a reaction mixture that contains a homo adapter-loaded tagmentase and does not contain adapter-loaded tagmentases having a different adapter.

2 . A method of sequencing a sequencing platform specific cDNA amplicon comprising:
providing the sequencing platform specific amplicon, wherein the sequencing platform specific amplicon comprises a double-stranded polynucleotide comprising:
i) a first end comprising SEQ ID NO:1;
ii) a second end comprising SEQ ID NO:2; and
iii) a middle region comprising a double-stranded cDNA polynucleotide comprising a first strand cDNA polynucleotide complementary to an mRNA sequence hybridized to a second strand cDNA polynucleotide that corresponds to the mRNA sequence; and
sequencing the amplicon from the second end with a second sequencing primer comprising SEQ ID NO:8.

3 . The method of claim 2 , wherein the first end comprises a 3′ poly-A region of the second strand cDNA polynucleotide that corresponds to a 3′ polyadenylation region of the mRNA sequence.

4 . The method of claim 3 , wherein the second strand cDNA polynucleotide has a length that is less than 90% of the length of a corresponding mRNA.

5 . The method of claim 2 , wherein the method comprises sequencing the amplicon from the first end with a first sequencing primer and then sequencing the amplicon from the second end with the second sequencing primer.

6 . The method of claim 5 , wherein the first sequencing primer comprises the sequence from 5′ to 3′ GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC (SEQ ID NO:9) or from 5′ to 3′ ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO:12).

7 . The method of claim 2 , wherein the second sequencing primer comprises from 5′ to 3′ AGATGTGTATAAGAGACAG (SEQ ID NO:10).

8 . The method of claim 2 , wherein the second sequencing primer comprises from 5′ to 3′ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (SEQ ID NO:11).

9 . A method of sequencing a plurality of sequencing platform specific cDNA amplicons comprising:
providing the plurality of sequencing platform specific amplicons, wherein the individual sequencing platform specific amplicons comprise a double-stranded polynucleotide comprising:
i) a first end comprising SEQ ID NO:1;
ii) a second end comprising SEQ ID NO:2; and
iii) a middle region comprising a double-stranded cDNA polynucleotide comprising a first strand cDNA polynucleotide complementary to an mRNA sequence hybridized to a second strand cDNA polynucleotide that corresponds to the mRNA sequence;
sequencing a portion of the amplicons from the second end with a second sequencing primer comprising SEQ ID NO:8; and sequencing a portion of the amplicons from the second end with a third sequencing primer comprising from 5′ to 3′GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO:12).

10 . The method of claim 9 , wherein the second sequencing primer comprises SEQ ID NO:11.

Assignees

• Bio Rad Laboratories
• Bio Rad Europe Gmbh

Inventors

• Lebofsky Ronald
• Agresti Jeremy

Classifications

• C12Q1/6806

  Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay (C12Q1/6804 takes precedence) · CPC title

• C12Q1/6844

  Nucleic acid amplification reactions · CPC title

• C12N15/1096 Primary

  cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR · CPC title

• C12N15/1065

  Preparation or screening of tagged libraries, e.g. tagged microorganisms by STM-mutagenesis, tagged polynucleotides, gene tags · CPC title

• C12Q1/6869 Primary

  Methods for sequencing · CPC title