Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

Patent metadata

Field	Value
Publication number	US-2018312876-A1
Application number	US-201816033016-A
Country	US
Kind code	A1
Filing date	Jul 11, 2018
Priority date	May 25, 2012
Publication date	Nov 1, 2018
Grant date	—

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

First claim

1 - 2 . (canceled)

3 . A method of targeting and binding a target DNA, modifying a target DNA, or modulating transcription from a target DNA, the method comprising:
contacting a target DNA inside of a cell with a complex that comprises: (a) a Cas9 protein; and (b) a non-naturally occurring DNA-targeting RNA comprising:
(i) a targeter-RNA that hybridizes with a target sequence of the target DNA; and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,
wherein: the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, and/or transcription from the target DNA is modulated.

4 . The method of claim 3 , wherein the target sequence of the target DNA is 15 nucleotides (nt) to 18 nt long.

5 . The method of claim 3 , wherein the target sequence of the target DNA is 18 nucleotides (nt) to 25 nt long.

6 . The method of claim 3 , wherein said contacting comprises inducing expression of (a) and/or (b).

7 . The method of claim 3 , wherein said contacting comprises introducing into the cell one or more of:
(1) the Cas9 protein, or a nucleic acid encoding the Cas9 protein; (2) the targeter-RNA, or a nucleic acid encoding the targeter-RNA; and (3) the activator-RNA, or a nucleic acid encoding the activator-RNA.

8 . The method of claim 7 , wherein one or more of:
(A) the nucleic acid encoding the Cas9 protein; (B) the nucleic acid encoding the targeter-RNA; and (C) the nucleic acid encoding the activator-RNA,
is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.

9 . The method of claim 7 , comprising introducing into the cell (1), (2), and (3).

10 . The method of claim 7 , wherein the nucleic acid encoding the Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9-encoding nucleotide sequence with one or more different codons encoding the same amino acid.

11 . The method of claim 3 , wherein the method comprises introducing a donor polynucleotide into the cell.

12 . The method of claim 3 , wherein the method comprises introducing into the cell a DNA molecule that encodes both the non-naturally occurring DNA-targeting RNA and the Cas9 protein.

13 . The method of claim 3 , wherein the targeter-RNA and the activator-RNA are covalently linked via the 3′ end of the targeter-RNA and the 5′ end of the activator-RNA.

14 . The method of claim 3 , wherein the method comprises introducing two or more of the non-naturally occurring DNA-targeting RNAs into the cell, wherein the two or more non-naturally occurring DNA-targeting RNAs are complementary to different target sequences within the same or different target DNAs.

15 . The method of claim 3 , wherein the cell is a bacterial cell or a eukaryotic cell.

16 . The method of claim 15 , wherein the eukaryotic cell is a mammalian cell.

17 . The method of claim 3 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

18 . The method of claim 3 , wherein the Cas9 protein is fused to a heterologous polypeptide.

19 . The method of claim 3 , wherein the targeter-RNA and the activator-RNA are not covalently linked by intervening nucleotides.

20 . The method of claim 3 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.

21 . The method of claim 3 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA).

22 . The method of claim 3 , wherein the targeter-RNA and the activator-RNA are conjugated to a heterologous moiety.

23 . The method of claim 3 , wherein the targeter-RNA and/or the activator-RNA is conjugated to one or more of: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine moiety; a hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; and a coumarin.

24 . The method of claim 3 , wherein the target DNA is chromosomal DNA.

25 . The method of claim 3 , wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CUUUUUUU (SEQ ID NO: 432).

26 . The method of claim 3 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).

27 . The method of claim 3 , wherein said contacting results in cleavage of the target DNA.

28 . The method of claim 3 , wherein the Cas9 protein is capable of cleaving only one strand of DNA and comprises one or more mutations in a RuvC domain or an HNH domain.

Assignees

• Charpentier Emmanuelle
• Univ California
• Univ Vienna

Inventors

• Doudna Jennifer A
• Jinek Martin
• Chylinski Krzysztof
• Charpentier Emmanuelle

Classifications

• H10P14/6512

  by exposure to a gas or vapour · CPC title

• H10P14/20

  of semiconductor materials · CPC title

• A61P43/00

  Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00 · CPC title

• A61P31/00

  Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics · CPC title

• A61P31/12

  Antivirals · CPC title