Compositions and methods for immunooncology
US-2024417722-A1 · Dec 19, 2024 · US
US2018312876A1 · US · A1
| Field | Value |
|---|---|
| Publication number | US-2018312876-A1 |
| Application number | US-201816033016-A |
| Country | US |
| Kind code | A1 |
| Filing date | Jul 11, 2018 |
| Priority date | May 25, 2012 |
| Publication date | Nov 1, 2018 |
| Grant date | — |
A practical reading order for non-experts. Skip the full description unless you need deep technical detail.
What the patent document calls the invention.
A short plain-language summary of the technical disclosure.
Who owns or filed the patent and who is credited as inventor.
Filing, priority, publication, and grant dates set the timeline.
The legal scope of protection — read this for what is actually claimed.
Technology tags used to group this patent with similar filings.
Prior art links and similar publications in this corpus.
Official abstract text for this publication.
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
Opening claim text (preview).
1 - 2 . (canceled) 3 . A method of targeting and binding a target DNA, modifying a target DNA, or modulating transcription from a target DNA, the method comprising: contacting a target DNA inside of a cell with a complex that comprises: (a) a Cas9 protein; and (b) a non-naturally occurring DNA-targeting RNA comprising: (i) a targeter-RNA that hybridizes with a target sequence of the target DNA; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs, wherein: the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, and/or transcription from the target DNA is modulated. 4 . The method of claim 3 , wherein the target sequence of the target DNA is 15 nucleotides (nt) to 18 nt long. 5 . The method of claim 3 , wherein the target sequence of the target DNA is 18 nucleotides (nt) to 25 nt long. 6 . The method of claim 3 , wherein said contacting comprises inducing expression of (a) and/or (b). 7 . The method of claim 3 , wherein said contacting comprises introducing into the cell one or more of: (1) the Cas9 protein, or a nucleic acid encoding the Cas9 protein; (2) the targeter-RNA, or a nucleic acid encoding the targeter-RNA; and (3) the activator-RNA, or a nucleic acid encoding the activator-RNA. 8 . The method of claim 7 , wherein one or more of: (A) the nucleic acid encoding the Cas9 protein; (B) the nucleic acid encoding the targeter-RNA; and (C) the nucleic acid encoding the activator-RNA, is a plasmid, a cosmid, a minicircle, a phage, or a viral vector. 9 . The method of claim 7 , comprising introducing into the cell (1), (2), and (3). 10 . The method of claim 7 , wherein the nucleic acid encoding the Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9-encoding nucleotide sequence with one or more different codons encoding the same amino acid. 11 . The method of claim 3 , wherein the method comprises introducing a donor polynucleotide into the cell. 12 . The method of claim 3 , wherein the method comprises introducing into the cell a DNA molecule that encodes both the non-naturally occurring DNA-targeting RNA and the Cas9 protein. 13 . The method of claim 3 , wherein the targeter-RNA and the activator-RNA are covalently linked via the 3′ end of the targeter-RNA and the 5′ end of the activator-RNA. 14 . The method of claim 3 , wherein the method comprises introducing two or more of the non-naturally occurring DNA-targeting RNAs into the cell, wherein the two or more non-naturally occurring DNA-targeting RNAs are complementary to different target sequences within the same or different target DNAs. 15 . The method of claim 3 , wherein the cell is a bacterial cell or a eukaryotic cell. 16 . The method of claim 15 , wherein the eukaryotic cell is a mammalian cell. 17 . The method of claim 3 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain. 18 . The method of claim 3 , wherein the Cas9 protein is fused to a heterologous polypeptide. 19 . The method of claim 3 , wherein the targeter-RNA and the activator-RNA are not covalently linked by intervening nucleotides. 20 . The method of claim 3 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase. 21 . The method of claim 3 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA). 22 . The method of claim 3 , wherein the targeter-RNA and the activator-RNA are conjugated to a heterologous moiety. 23 . The method of claim 3 , wherein the targeter-RNA and/or the activator-RNA is conjugated to one or more of: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine moiety; a hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; and a coumarin. 24 . The method of claim 3 , wherein the target DNA is chromosomal DNA. 25 . The method of claim 3 , wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CUUUUUUU (SEQ ID NO: 432). 26 . The method of claim 3 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441). 27 . The method of claim 3 , wherein said contacting results in cleavage of the target DNA. 28 . The method of claim 3 , wherein the Cas9 protein is capable of cleaving only one strand of DNA and comprises one or more mutations in a RuvC domain or an HNH domain.
by exposure to a gas or vapour · CPC title
of semiconductor materials · CPC title
Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00 · CPC title
Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics · CPC title
Antivirals · CPC title
Related publications grouped by family.
Answers are generated from the same data shown on this page.