Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

US2018312875A1 · US · A1

Patent metadata
FieldValue
Publication numberUS-2018312875-A1
Application numberUS-201816033005-A
CountryUS
Kind codeA1
Filing dateJul 11, 2018
Priority dateMay 25, 2012
Publication dateNov 1, 2018
Grant date

How to read this patent

A practical reading order for non-experts. Skip the full description unless you need deep technical detail.

  1. Title

    What the patent document calls the invention.

  2. Abstract

    A short plain-language summary of the technical disclosure.

  3. Assignees and inventors

    Who owns or filed the patent and who is credited as inventor.

  4. Key dates

    Filing, priority, publication, and grant dates set the timeline.

  5. First independent claim

    The legal scope of protection — read this for what is actually claimed.

  6. CPC / IPC classifications

    Technology tags used to group this patent with similar filings.

  7. Citations and related patents

    Prior art links and similar publications in this corpus.

Abstract

Official abstract text for this publication.

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

First claim

Opening claim text (preview).

1 - 2 . (canceled) 3 . A method of targeting and binding a target DNA, modifying a target DNA, or modulating transcription from a target DNA, the method comprising: contacting a target DNA with a complex that comprises: (a) a Cas9 protein; and (b) a single molecule DNA-targeting RNA that comprises, in 5′ to 3′ order: (i) a targeter-RNA that hybridizes with a target sequence of the target DNA; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs, wherein (i) and (ii) are covalently linked by intervening nucleotides, and wherein: the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, and/or transcription from the target DNA is modulated. 4 . The method of claim 3 , wherein said contacting occurs inside of a bacterial cell or a eukaryotic cell. 5 . The method of claim 4 , wherein the eukaryotic cell is a mammalian cell. 6 . The method of claim 4 , wherein the method comprises introducing into the bacterial cell or the eukaryotic cell: (1) the single molecule DNA-targeting RNA, or a nucleic acid that encodes the single molecule DNA-targeting RNA; and/or (2) the Cas9 protein, or a nucleic acid that encodes the Cas9 protein. 7 . The method of claim 4 , wherein the method comprises introducing into the bacterial cell or the eukaryotic cell, a DNA molecule that encodes both the single molecule DNA-targeting RNA and the Cas9 protein. 8 . The method of claim 4 , wherein the method comprises introducing a donor polynucleotide into the bacterial cell or the eukaryotic cell. 9 . The method of claim 3 , wherein the target sequence of the target DNA is 15 nucleotides (nt) to 25 nt long. 10 . The method of claim 3 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain. 11 . A method of targeting and binding a target DNA, modifying a target DNA, or modulating transcription from a target DNA, the method comprising: contacting a target DNA with a complex that comprises: (a) a Cas9 protein; and (b) a single molecule DNA-targeting RNA that comprises, in 5′ to 3′ order: (i) a targeter-RNA that hybridizes with a target sequence of the target DNA; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 15 to 18 base pairs, wherein (i) and (ii) are covalently linked by intervening nucleotides, and wherein: the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, and/or transcription from the target DNA is modulated. 12 . The method of claim 11 , wherein said contacting occurs inside of a bacterial cell or a eukaryotic cell. 13 . The method of claim 12 , wherein the eukaryotic cell is a mammalian cell. 14 . The method of claim 12 , wherein the method comprises introducing into the bacterial cell or the eukaryotic cell: (1) the single molecule DNA-targeting RNA, or a nucleic acid that encodes the single molecule DNA-targeting RNA; and/or (2) the Cas9 protein, or a nucleic acid that encodes the Cas9 protein. 15 . The method of claim 12 , wherein the method comprises introducing into the bacterial cell or the eukaryotic cell, a DNA molecule that encodes both the single molecule DNA-targeting RNA and the Cas9 protein. 16 . The method of claim 12 , wherein the method comprises introducing a donor polynucleotide into the bacterial cell or the eukaryotic cell. 17 . The method of claim 11 , wherein the target sequence of the target DNA is 15 nucleotides (nt) to 25 nt long. 18 . The method of claim 11 , wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or an HNH domain. 19 . A composition comprising a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises, in 5′ to 3′ order: (i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA, and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs, wherein (i) and (ii) are covalently linked by intervening nucleotides, and wherein the single molecule DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA. 20 . The composition of claim 19 , wherein the nucleic acid encoding the single molecule DNA-targeting RNA is a plasmid, a cosmid, a minicircle, a phage, or a viral vector. 21 . The composition of claim 19 , wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence (SEQ ID NO: 432) UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC GAGUCGGUGCUUUUUUU. 22 . The composition of claim 19 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441). 23 . The composition of claim 19 , wherein the single molecule DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase. 24 . The composition of claim 19 , wherein the single molecule DNA-targeting RNA comprises one or more of: a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholine nucleic acid, and a cyclohexenyl nucleic acid (CeNA). 25 . The composition of claim 19 , wherein the single molecule DNA-targeting RNA, or the nucleic acid encoding the single molecule DNA-targeting RNA, is conjugated to one or more of: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine moiety; a hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; and a coumarin. 26 . A single molecule DNA-targeting RNA, or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises, in 5′ to 3′ order: (i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA, and (ii) an activator-RNA that hybridizes with the t

Assignees

Inventors

Classifications

  • by exposure to a gas or vapour · CPC title

  • of semiconductor materials · CPC title

  • Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00 · CPC title

  • Antibacterial agents · CPC title

  • Antivirals · CPC title

Patent family

Related publications grouped by family.

External sources

Frequently asked questions

Answers are generated from the same data shown on this page.

What does patent US2018312875A1 cover?
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification …
Who is the assignee on this patent?
Charpentier Emmanuelle, Univ California, Univ Vienna
What technology area does this patent fall under?
Primary CPC classification C12N15/907. Mapped technology areas include Chemistry & Metallurgy.
When was this patent published?
Publication date Thu Nov 01 2018 00:00:00 GMT+0000 (Coordinated Universal Time) (A1). Legal status and post-grant events are not shown on this page.
What related patents are in patentsdb?
We list 1 related publication on this page (citations in our corpus or others sharing the same primary CPC).