Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

Patent metadata

Field	Value
Publication number	US-2018312875-A1
Application number	US-201816033005-A
Country	US
Kind code	A1
Filing date	Jul 11, 2018
Priority date	May 25, 2012
Publication date	Nov 1, 2018
Grant date	—

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

First claim

1 - 2 . (canceled)

3 . A method of targeting and binding a target DNA, modifying a target DNA, or modulating transcription from a target DNA, the method comprising:
contacting a target DNA with a complex that comprises: (a) a Cas9 protein; and (b) a single molecule DNA-targeting RNA that comprises, in 5′ to 3′ order:
(i) a targeter-RNA that hybridizes with a target sequence of the target DNA; and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,
wherein (i) and (ii) are covalently linked by intervening nucleotides,

and wherein: the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, and/or transcription from the target DNA is modulated.

4 . The method of claim 3 , wherein said contacting occurs inside of a bacterial cell or a eukaryotic cell.

5 . The method of claim 4 , wherein the eukaryotic cell is a mammalian cell.

6 . The method of claim 4 , wherein the method comprises introducing into the bacterial cell or the eukaryotic cell:
(1) the single molecule DNA-targeting RNA, or a nucleic acid that encodes the single molecule DNA-targeting RNA; and/or (2) the Cas9 protein, or a nucleic acid that encodes the Cas9 protein.

7 . The method of claim 4 , wherein the method comprises introducing into the bacterial cell or the eukaryotic cell, a DNA molecule that encodes both the single molecule DNA-targeting RNA and the Cas9 protein.

8 . The method of claim 4 , wherein the method comprises introducing a donor polynucleotide into the bacterial cell or the eukaryotic cell.

9 . The method of claim 3 , wherein the target sequence of the target DNA is 15 nucleotides (nt) to 25 nt long.

10 . The method of claim 3 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.

11 . A method of targeting and binding a target DNA, modifying a target DNA, or modulating transcription from a target DNA, the method comprising:
contacting a target DNA with a complex that comprises: (a) a Cas9 protein; and (b) a single molecule DNA-targeting RNA that comprises, in 5′ to 3′ order:
(i) a targeter-RNA that hybridizes with a target sequence of the target DNA; and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 15 to 18 base pairs,
wherein (i) and (ii) are covalently linked by intervening nucleotides,

and wherein: the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, and/or transcription from the target DNA is modulated.

12 . The method of claim 11 , wherein said contacting occurs inside of a bacterial cell or a eukaryotic cell.

13 . The method of claim 12 , wherein the eukaryotic cell is a mammalian cell.

14 . The method of claim 12 , wherein the method comprises introducing into the bacterial cell or the eukaryotic cell:
(1) the single molecule DNA-targeting RNA, or a nucleic acid that encodes the single molecule DNA-targeting RNA; and/or (2) the Cas9 protein, or a nucleic acid that encodes the Cas9 protein.

15 . The method of claim 12 , wherein the method comprises introducing into the bacterial cell or the eukaryotic cell, a DNA molecule that encodes both the single molecule DNA-targeting RNA and the Cas9 protein.

16 . The method of claim 12 , wherein the method comprises introducing a donor polynucleotide into the bacterial cell or the eukaryotic cell.

17 . The method of claim 11 , wherein the target sequence of the target DNA is 15 nucleotides (nt) to 25 nt long.

18 . The method of claim 11 , wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or an HNH domain.

19 . A composition comprising a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises, in 5′ to 3′ order:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA, and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,
wherein (i) and (ii) are covalently linked by intervening nucleotides, and

wherein the single molecule DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA.

20 . The composition of claim 19 , wherein the nucleic acid encoding the single molecule DNA-targeting RNA is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.

21 . The composition of claim 19 , wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence

(SEQ ID NO: 432)

UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC

GAGUCGGUGCUUUUUUU.

22 . The composition of claim 19 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).

23 . The composition of claim 19 , wherein the single molecule DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.

24 . The composition of claim 19 , wherein the single molecule DNA-targeting RNA comprises one or more of: a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholine nucleic acid, and a cyclohexenyl nucleic acid (CeNA).

25 . The composition of claim 19 , wherein the single molecule DNA-targeting RNA, or the nucleic acid encoding the single molecule DNA-targeting RNA, is conjugated to one or more of: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine moiety; a hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; and a coumarin.

26 . A single molecule DNA-targeting RNA, or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises, in 5′ to 3′ order:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA, and
(ii) an activator-RNA that hybridizes with the t

Assignees

• Charpentier Emmanuelle
• Univ California
• Univ Vienna

Inventors

• Doudna Jennifer A
• Jinek Martin
• Chylinski Krzysztof
• Charpentier Emmanuelle

Classifications

• H10P14/6512

  by exposure to a gas or vapour · CPC title

• H10P14/20

  of semiconductor materials · CPC title

• A61P43/00

  Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00 · CPC title

• A61P31/04

  Antibacterial agents · CPC title

• A61P31/12

  Antivirals · CPC title