Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

Patent metadata

Field	Value
Publication number	US-2018298407-A1
Application number	US-201815959735-A
Country	US
Kind code	A1
Filing date	Apr 23, 2018
Priority date	May 25, 2012
Publication date	Oct 18, 2018
Grant date	—

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

First claim

1 - 2 . (canceled)

3 . A method for site-specific modification of a target DNA molecule, the method comprising:
(A) assembling, in vitro outside of a cell, a DNA-targeting RNA/polypeptide complex comprising:
(i) a Cas9 protein;
(ii) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the target DNA molecule; and
(iii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex, of a DNA-targeting RNA, that binds to the Cas9 protein,
wherein said assembling comprises combining (i), (ii), and (iii) under conditions suitable for formation of the DNA-targeting RNA/polypeptide complex; and
(B) contacting the target DNA molecule with the DNA-targeting RNA/polypeptide complex, wherein the DNA-targeting RNA guides the DNA-targeting RNA/polypeptide complex to the target sequence of the target DNA molecule, wherein the Cas9 protein and the DNA-targeting RNA do not naturally occur together, and wherein said site-specific modification of the target DNA molecule is cleavage of the target DNA molecule.

4 . The method of claim 3 , wherein the nucleotide sequence of the targeter-RNA that is complementary to the target sequence of the target DNA molecule is about 20 nucleotides long.

5 . The method of claim 3 , wherein the nucleotide sequence, of the targeter-RNA that is complementary to the target sequence of the target DNA molecule is 18 to 25 nucleotides long.

6 . The method of claim 5 , wherein the targeter-RNA comprises the 22 nucleotide sequence guuuuagagcuaugcuguuuug (SEQ ID No: 568) which is positioned 3′ of the nucleotide sequence that is complementary to the target sequence of the target DNA molecule.

7 . The method of claim 3 , wherein the Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or an HNH domain.

8 . The method of claim 3 , wherein, prior to assembly of the DNA-targeting RNA/polypeptide complex, the targeter-RNA and the activator-RNA are produced by in vitro transcription or chemical synthesis; and the Cas9 protein is produced from a recombinant expression vector or by in vitro synthesis.

9 . The method of claim 8 , wherein the Cas9 protein, is produced from a recombinant expression vector in a genetically modified prokaryotic host cell.

10 . The method of claim 9 , wherein the Cas9 protein is purified from a lysate of the genetically modified prokaryotic host cell.

11 . The method of claim 8 , wherein the Cas9 protein, the targeter-RNA, and the activator-RNA are each produced from one or more recombinant expression vectors in a genetically modified prokaryotic host cell.

12 . The method of claim 11 , wherein the genetically modified prokaryotic host cell is produced by introducing at least one plasmid encoding the Cas9 protein, the targeter-RNA, and the activator-RNA into a prokaryotic cell to result in the genetically modified prokaryotic host cell.

13 . The method of claim 11 , wherein the genetically modified prokaryotic host cell is produced by introducing plasmids, each encoding one of the Cas9 protein, the targeter-RNA, and the activator-RNA, into a prokaryotic cell to result in the genetically modified prokaryotic host cell.

14 . The method of claim 3 , wherein the Cas9 protein comprises the amino acid sequence set forth as SEQ ID NO: 41.

15 . A method for site-specific modification of a target DNA molecule, the method comprising:
(1) incubating, in vitro outside of a cell, a targeter-RNA with an activator-RNA to form a DNA-targeting RNA,
wherein the targeter-RNA comprises a nucleotide sequence that is complementary to a target sequence of the target DNA molecule, and the targeter-RNA and activator-RNA hybridize with one another to form a duplex;
(2) assembling, in vitro outside of a cell, a DNA-targeting RNA/polypeptide complex by combining the DNA-targeting RNA with a Cas9 protein, wherein the DNA-targeting RNA/polypeptide complex comprises the Cas9 protein, the targeter-RNA, and the activator-RNA; and (3) contacting the target DNA molecule with the DNA-targeting RNA/polypeptide complex, wherein the DNA-targeting RNA guides the DNA-targeting RNA/polypeptide complex to the target sequence of the target DNA molecule, wherein the Cas9 protein and the DNA-targeting RNA do not naturally occur together, and wherein said site-specific modification of the target DNA molecule is cleavage of the target DNA molecule.

16 . The method of claim 15 , wherein the nucleotide sequence, of the targeter-RNA, that is complementary to the target sequence of the target DNA molecule is about 20 nucleotides long.

17 . The method of claim 15 , wherein the nucleotide sequence, of the targeter-RNA, that is complementary to the target sequence of the target DNA molecule is 18 to 25 nucleotides long.

18 . The method of claim 15 , wherein the targeter-RNA comprises the 22 nucleotide sequence guuuuagagcuaugcuguuuug (SEQ ID No: 568) which is positioned 3′ of the nucleotide sequence that is complementary to the target sequence of the target DNA molecule.

19 . The method of claim 15 , wherein the Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or an HNH domain.

20 . The method of claim 15 , wherein, prior to said incubating, the targeter-RNA and the activator-RNA are produced by in vitro transcription or chemical synthesis; and prior to said assembling, the Cas9 protein is produced from a recombinant expression vector or by in vitro synthesis.

21 . The method of claim 20 , wherein the Cas9 protein, is produced from a recombinant expression vector in a genetically modified prokaryotic host cell.

22 . The method of claim 21 , wherein the Cas9 protein is purified from a lysate of the genetically modified prokaryotic host cell.

23 . The method of claim 20 , wherein the Cas9 protein, the targeter-RNA, and the activator-RNA are each produced from one or more recombinant expression vectors in a genetically modified prokaryotic host cell.

24 . The method of claim 23 , wherein the genetically modified prokaryotic host cell is produced by introducing at least one plasmid encoding the Cas9 protein, the targeter-RNA, and the activator-RNA into a prokaryotic cell to result in the genetically modified prokaryotic host cell.

25 . The method of claim 23 , wherein the genetically modified prokaryotic host cell is produced by introducing plasmids, each encoding one of the Cas9 protein, the targeter-RNA, and the activator-RNA, into a prokaryotic cell to result in the genetically modified prokaryotic host cell.

26 . The method of claim 15 , wherein the Cas9 protein comprises the amino acid sequence set forth as SEQ ID NO: 41.

Assignees

• Charpentier Emmanuelle
• Univ California
• Univ Vienna

Inventors

• Doudna Jennifer A
• Jinek Martin
• Chylinski Krzysztof
• Charpentier Emmanuelle

Classifications

• H10P14/6512

  by exposure to a gas or vapour · CPC title

• H10P14/20

  of semiconductor materials · CPC title

• A61P43/00

  Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00 · CPC title

• A61P35/00

  Antineoplastic agents · CPC title

• A61P31/12

  Antivirals · CPC title