Methods of detection and removal of rhabdoviruses from cell lines

US2016244487A1 · US · A1

Patent metadata
FieldValue
Publication numberUS-2016244487-A1
Application numberUS-201415026719-A
CountryUS
Kind codeA1
Filing dateOct 3, 2014
Priority dateOct 3, 2013
Publication dateAug 25, 2016
Grant date

How to read this patent

A practical reading order for non-experts. Skip the full description unless you need deep technical detail.

  1. Title

    What the patent document calls the invention.

  2. Abstract

    A short plain-language summary of the technical disclosure.

  3. Assignees and inventors

    Who owns or filed the patent and who is credited as inventor.

  4. Key dates

    Filing, priority, publication, and grant dates set the timeline.

  5. First independent claim

    The legal scope of protection — read this for what is actually claimed.

  6. CPC / IPC classifications

    Technology tags used to group this patent with similar filings.

  7. Citations and related patents

    Prior art links and similar publications in this corpus.

Abstract

Official abstract text for this publication.

The present disclosure relates to compositions, methods, mixtures, and kits for detecting the presence of and for removing, a virus from a product produced in an insect cell. The disclosure also relates to proteins, peptides, polypeptides, drug substances, biological products, vaccine antigens, and virus-like particles that are produced in an insect cell and that are free or substantially free of a virus. The disclosure also relates to compositions, methods, assays, and kits for detecting a rhabdovirus in a sample.

First claim

Opening claim text (preview).

1 . A method for detecting a virus comprising detecting a nucleic acid sequence comprising at least 50 contiguous nucleotides of SEQ ID NO: 1 or the reverse complement sequence of SEQ ID NO: 1. 2 - 3 . (canceled) 4 . The method of claim 1 , wherein the method comprises using one or more primers and one or more labeled probes in a PCR assay. 5 . The method of claim 4 , wherein the method comprises using a forward primer having a sequence according to SEQ ID NO: 2 (TCTGTATTATGGGTTTGATCAGCTAAG), and a reverse primer having a sequence according to SEQ ID NO: 3 (CTCGCTGCTGAGCGGTTT). 6 . The method of claim 5 , wherein the nucleotide sequence of the labeled probe is according to SEQ ID NO: 4 (AGGATTGGAGAATTATAC). 7 . The method of claim 1 , wherein the method has a sensitivity level of between about 2 molecules of RNA and about 20 molecules of RNA. 8 - 9 . (canceled) 10 . A method for removing a virus from a protein or virus-like particle (VLP) preparation derived from an insect cell, wherein the virus comprises a sequence having at least 70% homology to SEQ ID NO: 1. 11 . The method of claim 10 , wherein the virus comprises a sequence according to SEQ ID NO: 1. 12 . The method of claim 10 , wherein the insect cell is an SF9 cell. 13 . The method of claim 12 , wherein the SF9 cell is derived from the cell line deposited as ATCC CRL-1711. 14 . A protein or virus-like particle (VLP) preparation derived from an insect cell, wherein the protein or VLP is substantially free of a virus comprising a nucleotide sequence having at least 70% homology to SEQ ID NO: 1. 15 . The protein or VLP of claim 14 , wherein the virus comprises a sequence according to SEQ ID NO: 1. 16 . The protein or VLP of claim 14 , wherein the insect cell is an SF9 cell. 17 . The protein or VLP of claim 16 , wherein the SF9 cell is derived from the cell line deposited as ATCC CRL-1711. 18 . A composition comprising a protein or virus like particle preparation produced in an insect cell, wherein the composition is substantially free of a virus comprising a sequence having at least 70% homology to SEQ ID NO: 1. 19 . The composition of claim 18 , wherein the virus comprises a sequence according to SEQ ID NO: 1. 20 . The composition of claim 18 , wherein the insect cell is an SF9 cell. 21 . The composition of claim 20 , wherein the SF9 cell is derived from the cell line deposited as ATCC CRL-1711. 22 . The composition of claim 18 , wherein the composition is a vaccine. 23 . A biologic approved for use in a human, substantially free of a virus having at least 70% homology to SEQ ID NO: 1, wherein the biologic is produced in an insect cell. 24 . The biologic of claim 23 , wherein the virus comprises a sequence according to SEQ ID NO: 1. 25 . The biologic of claim 23 , wherein the insect cell is an SF9 cell. 26 . The biologic of claim 25 , wherein the SF9 cell is derived from the cell line deposited as ATCC CRL-1711. 27 . The biologic of claim 23 , wherein the biologic is a vaccine or a virus-like particle preparation. 28 - 31 . (canceled) 32 . A method for detecting particle-associated Sf9 rhabdovirus in a sample, the method comprising the following steps: (i) treating the sample with RNase; (ii) inactivating the RNase and disrupting particles in the sample; (iii) detecting the presence or absence of Sf9 rhabdovirus RNA in the RNase-treated sample by RT-PCR; wherein the presence of Sf9 rhabdovirus RNA in the RNase-treated sample indicates that the detected Sf9 rhabdovirus is aggregated onto or packaged within particles in the sample. 33 . The method of claim 32 , wherein the RNase is RNase A. 34 . The method of claim 32 , wherein the RT-PCR is conducted using a forward primer having a sequence according to SEQ ID NO: 2, a reverse primer having a sequence according to SEQ ID NO: 3, and a probe having a sequence according to SEQ ID NO: 4. 35 . The method of claim 32 , wherein step (ii) is conducted using a chaotropic agent 36 . The method of claim 32 , further comprising detecting the presence or absence of Sf9 rhabdovirus RNA in the sample by RT-PCR prior to treatment of the sample with RNase. 37 . A method for detecting replication competent Sf9 rhabdovirus in a sample, the method comprising incubating the sample with a Spodoptera exigua cell line, passaging the cell line at least once following incubation with the sample, and detecting the presence or absence of Sf9 rhabdovirus RNA at the following time-points: after incubating the cell line with the sample and after each passage of the cells; wherein an increase in the level of Sf9 rhabdovirus RNA signal after at least one of the one or more passages relative to the level of Sf9 rhabdovirus RNA signal detected immediately after incubation of the cell line with the sample indicates that the Sf9 rhabdovirus is present in the sample and is capable of replication. 38 . A method for detecting the presence or absence of replication competent particle-associated Sf9 rhabdovirus in a sample, the method comprising: (i) treating the sample with RNase; (ii) inactivating the RNase and disrupting particles in the sample; (iii) detecting the presence or absence of Sf9 rhabdovirus RNA in the RNase treated sample by RT-PCR; (iv) incubating the RNase-treated sample with a Spodoptera exigua cell line; (v) passaging the cell line at least once; (vi) purifying total RNA from the cell line at the following time points: after incubation with the RNase treated sample, and after each of the at least one cell passages; and (vii) detecting Sf9 rhabdovirus RNA in the total RNA from each time point by RT-PCR; wherein an increase in the level of Sf9 rhabdovirus RNA detected after at least one passage relative to the level of Sf9 rhabdovirus RNA detected immediately following incubation of the cell line with the RNase-treated sample indicates that the Sf9 rhabdovirus is capable of replication. 39 . The method of claim 38 , wherein the RNase is RNase A. 40 . The method of claim 38 , wherein the RT-PCR is conducted using a forward primer having a sequence according to SEQ ID NO: 2, a reverse primer having a sequence according to SEQ ID NO: 3, and a probe having a sequence according to SEQ ID NO: 4. 41 . The method of claim 38 , wherein step (ii) is conducted using a chaotropic agent 42 . The method of claim 38 , further comprising detecting the presence or absence of Sf9 rhabdovirus RNA in the sample by RT-PCR prior to treatment of the sample with RNase. 43 . The method of claim 38 , wherein the sample is a drug substance, and wherein the method is used in a release assay for the drug substance. 44 . (canceled) 45 . A composition comprising S. exigua cells and a rhabdovirus. 46 . The composition of claim 45 , wherein the rhabdovirus comprises a sequence having at least 70% homology to SEQ ID NO: 1. 47 . The composition of claim 46 , wherein the rhabdovirus comprises a sequence according to SEQ ID NO: 1.

Assignees

Inventors

Classifications

  • Viruses as such, e.g. new isolates, mutants or their genomic sequences · CPC title

  • Methods of production or purification of viral material · CPC title

  • Virus like particles [VLP] · CPC title

  • C12N7/00Primary

    Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof (preparing medicinal viral antigen or antibody compositions, e.g. virus vaccines, A61K39/00) · CPC title

  • Virus-like particles · CPC title

Patent family

Related publications grouped by family.

External sources

Frequently asked questions

Answers are generated from the same data shown on this page.

What does patent US2016244487A1 cover?
The present disclosure relates to compositions, methods, mixtures, and kits for detecting the presence of and for removing, a virus from a product produced in an insect cell. The disclosure also relates to proteins, peptides, polypeptides, drug substances, biological products, vaccine antigens, and virus-like particles that are produced in an insect cell and that are free or substantially free …
Who is the assignee on this patent?
Takeda Vaccines Inc
What technology area does this patent fall under?
Primary CPC classification C12N7/00. Mapped technology areas include Chemistry & Metallurgy.
When was this patent published?
Publication date Thu Aug 25 2016 00:00:00 GMT+0000 (Coordinated Universal Time) (A1). Legal status and post-grant events are not shown on this page.
What related patents are in patentsdb?
We list 8 related publications on this page (citations in our corpus or others sharing the same primary CPC).