Synthetic production of circular dna vectors
US-2024409975-A1 · Dec 12, 2024 · US
Optimized expression cassette for expressing a polypeptide with high yield
US2016186206A1 · US · A1
| Field | Value |
|---|---|
| Publication number | US-2016186206-A1 |
| Application number | US-201314443863-A |
| Country | US |
| Kind code | A1 |
| Filing date | Nov 18, 2013 |
| Priority date | Nov 20, 2012 |
| Publication date | Jun 30, 2016 |
| Grant date | — |
How to read this patent
A practical reading order for non-experts. Skip the full description unless you need deep technical detail.
- Title
What the patent document calls the invention.
- Abstract
A short plain-language summary of the technical disclosure.
- Assignees and inventors
Who owns or filed the patent and who is credited as inventor.
- Key dates
Filing, priority, publication, and grant dates set the timeline.
- First independent claim
The legal scope of protection — read this for what is actually claimed.
- CPC / IPC classifications
Technology tags used to group this patent with similar filings.
- Citations and related patents
Prior art links and similar publications in this corpus.
Abstract
Official abstract text for this publication.
The present invention is based on the finding that the combination of a specific 5′UTR polynucleotide sequence (see SEQ ID NO 1) and the hCD33 secretory leader sequence in an expression cassette for expressing a polypeptide of interest results in a surprisingly better expression level of the polypeptide of interest compared to prior art expression cassettes. Based on this finding, the present invention inter alia provides novel expression cassettes, expression vectors and methods for producing a polypeptide of interest with high yield.
First claim
Opening claim text (preview).
1 . An expression cassette suitable for expressing a polypeptide of interest comprising: a) a promoter; b) a 5′UTR polynucleotide sequence, wherein said 5′UTR polynucleotide sequence is selected from the group consisting of i) a 5′UTR polynucleotide sequence comprising the following sequence (SEQ ID NO 1) agatcgcctggagacgccatccacgctgttttgacctccatagaagacac cgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggat tccccgtgccaagagtgacgtaagtaccgcctatagagtctataggccca cccccttggcttcgttagaacgcggctacaattaatacataaccttatgt atcatacacatacgatttaggtgacactatagaataacatccactttgcc tttctctccacaggtgtccactcccaggtccaactgca; ii) a 5′UTR polynucleotide sequence comprising the following sequence (SEQ ID NO 2) agatcgcctggagacgccatccacgctgttttgacctccatagaagacac cgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggat tccccgtgccaagagtgacgtaagtaccgcctatagagtctataggccca cccccttggcttcgttagaacgcggctacaattaatacataaccttatgt atcatacacatacgatttaggtgacactatagaataacatccactttgcc tttctctccacaggtgtccactcccaggtccaactgcacctcggttctat cg; iii) a 5′UTR polynucleotide sequence comprising the following sequence (SEQ ID NO 3) agatcgcctggagacgccatccacgctgttttgacctccatagaagacac cgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggat tccccgtgccaagagtgacgtaagtaccgcctatagagtctataggccca cccccttggcttcgttagaacgcggctacaattaatacataaccttatgt atcatacacatacgatttaggtgacactatagaataacatccactttgcc tttctctccacaggtgtccactcccaggtccaactgcacctcggttctat cgaaaacgcgtccacc; iv) a 5′UTR polynucleotide sequence comprising the following sequence (SEQ ID NO 4) agatcgcctggagacgccatccacgctgttttgacctccatagaagacac cgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggat tccccgtgccaagagtgacgtaagtaccgcctatagagtctataggccca cccccttggcttcgttagaacgcggctacaattaatacataaccttatgt atcatacacatacgatttaggtgacactatagaataacatccactttgcc tttctctccacaggtgtccactcccaggtccaactgcacctcggttctat cgcgattgaattccccggggatcctctagggtgaccgtttggtgccgcca cc; v) a 5′UTR polynucleotide sequence comprising the following sequence (SEQ ID NO 5) agatcgcctggagacgccatccacgctgttttgacctccatagaagacac cgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggat tccccgtgccaagagtgacgtaagtaccgcctatagagtctataggccca cccccttggcttcgttagaacgcggctacaattaatacataaccttatgt atcatacacatacgatttaggtgacactatagaataacatccactttgcc tttctctccacaggtgtccactcccaggtccaactgcacctcggttctat cgaaaacgcgcctctagagccgccacc; vi) a 5′UTR polynucleotide sequence comprising the following sequence (SEQ ID NO 6) agatcgcctggagacgccatccacgctgttttgacctccatagaagacac cgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggat tccccgtgccaagagtgacgtaagtaccgcctatagagtctataggccca cccccttggcttcgttagaacgcggctacaattaatacataaccttatgt atcatacacatacgatttaggtgacactatagaataacatccactttgcc tttctctccacaggtgtccactcccaggtccaactgcacctcggttctat
Assignees
Inventors
Classifications
Patent family
Related publications grouped by family.
External sources
Frequently asked questions
Answers are generated from the same data shown on this page.
- What does patent US2016186206A1 cover?
- The present invention is based on the finding that the combination of a specific 5′UTR polynucleotide sequence (see SEQ ID NO 1) and the hCD33 secretory leader sequence in an expression cassette for expressing a polypeptide of interest results in a surprisingly better expression level of the polypeptide of interest compared to prior art expression cassettes. Based on this finding, the present i…
- Who is the assignee on this patent?
- Grover Bhadra S, Air Liquide
- What technology area does this patent fall under?
- Primary CPC classification C12N15/85. Mapped technology areas include Chemistry & Metallurgy.
- When was this patent published?
- Publication date Thu Jun 30 2016 00:00:00 GMT+0000 (Coordinated Universal Time) (A1). Legal status and post-grant events are not shown on this page.
- What related patents are in patentsdb?
- We list 8 related publications on this page (citations in our corpus or others sharing the same primary CPC).