Methods for modulating chemotherapeutic cytotoxicity

Patent metadata

Field	Value
Publication number	US-2016045532-A1
Application number	US-201414775428-A
Country	US
Kind code	A1
Filing date	Mar 13, 2014
Priority date	Mar 13, 2013
Publication date	Feb 18, 2016
Grant date	—

Abstract

Disclosed herein are methods of reducing cytotoxicity of a chemotherapeutic agent to non-cancer cells by administering to a subject with cancer an effective amount of an agent that inhibits CD47 signaling and a chemotherapeutic agent. Example disclosed methods reduce cardiotoxicity of a chemotherapeutic agent. Also disclosed are methods of increasing cytotoxicity of a chemotherapeutic agent in cancer cells by administering to a subject with a tumor an effective amount of an agent that inhibits CD47 signaling and a chemotherapeutic agent. In some embodiments, the inhibitor of CD47 signaling is administered to the subject before, during, or after the administration of the chemotherapeutic agent.

First claim

1 . A method of reducing cytotoxicity of a chemotherapeutic agent to non-cancer cells, comprising administering to a subject with cancer an effective amount of an agent that inhibits CD47 signaling and one or more chemotherapeutic agents, wherein the agent that inhibits CD47 signaling is administered to the subject before, during, or after administration of the one or more chemotherapeutic agents.

2 . The method of claim 1 , wherein the chemotherapeutic agent comprises a DNA damaging agent, an antimetabolite chemotherapeutic agent, or a topoisomerase inhibitor.

3 . The method of claim 1 , wherein the one or more chemotherapeutic agents comprise an anthracycline or an anthracycline-like agent.

4 . The method of claim 3 , wherein the anthracycline or anthracycline like agent comprises doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicin, or mitoxantrone.

5 . (canceled)

6 . The method of claim 2 , wherein the antimetabolite chemotherapeutic agent comprises cladribine, clofarabine, fludarabine, mercaptopurine, thioguanine, pentostatin, capecitabine, cytarabine, 5-fluorouracil, floxuridine, or gemcitabine.

7 . (canceled)

8 . The method of claim 2 , wherein the topoisomerase inhibitor comprises camptothecin, topotecan, irinotecan, or etoposide.

9 . The method of claim 1 , wherein the agent that inhibits CD47 signaling comprises an anti-CD47 antibody or fragment thereof, a CD47-binding peptide, a CD47 antisense oligonucleotide, a CD47 morpholino, an anti-TSP1 antibody or fragment thereof, a TSP1-binding peptide, a TSP1 antisense oligonucleotide, a TSP1 morpholino, a small molecule capable of binding to CD47, or a small molecule capable of binding to TSP1.

10 . The method of claim 9 , wherein the agent that inhibits CD47 signaling comprises a CD47 morpholino comprising the nucleic acid sequence set forth as CGTCACAGGCAGGACCCACTGCCCA (SEQ ID NO: 3).

11 . The method of claim 9 , wherein the agent that inhibits CD47 signaling comprises a CD47-binding peptide comprising the amino acid sequence set forth as FIRVVMYEGKK (7N3 peptide; SEQ ID NO: 1) or RFYVVMWK (4N1 peptide; SEQ ID NO: 2).

12 . The method of claim 9 , wherein the agent that inhibits CD47 signaling comprises an anti-CD47 antibody or fragment thereof comprising anti-human CD47 antibody B6H12.

13 . (canceled)

14 . The method of claim 1 , wherein the subject with cancer has breast cancer, lung cancer, ovarian cancer, prostate cancer, thyroid cancer, bladder cancer, stomach cancer, multiple myeloma, soft tissue sarcoma, leukemia, or lymphoma.

15 . (canceled)

16 . The method of claim 1 , wherein the cytotoxicity of the chemotherapeutic agent to non-cancer cells comprises cardiotoxicity, nephrotoxicity, hepatotoxicity, myelosuppression, alopecia, gastrointestinal distress, or peripheral neuropathy.

17 . (canceled)

18 . The method of claim 1 , wherein the agent that inhibits CD47 signaling is administered to the subject prior to administration of the chemotherapeutic agent.

19 . The method of claim 18 , wherein the agent that inhibits CD47 signaling is administered to the subject at least about 24 hours prior to administration of the chemotherapeutic agent or at least about 48 hours prior to the administration of the chemotherapeutic agent.

20 . (canceled)

21 . The method of claim 1 , further comprising detecting cytotoxicity to non-cancer cells in the subject.

22 . The method of claim 1 , further comprising selecting a subject who is at risk for cytotoxicity of the chemotherapeutic agent to non-cancer cells for administration of the agent that inhibits CD47 signaling and the chemotherapeutic agent.

23 - 24 . (canceled)

25 . A method of reducing cytotoxicity of a chemotherapeutic agent to non-cancer cells, comprising:
(a) administering an agent that inhibits CD47 signaling to a subject with cancer; (b) administering one or more chemotherapeutic agents to the subject with cancer, wherein (a) and (b) can be performed in either order or concurrently; and (c) detecting a reduction of cytotoxicity to non-cancer cells in the subject.

26 . The method of claim 25 , further comprising selecting a subject who is at risk for cytotoxicity of the chemotherapeutic agent to non-cancer cells for administration of the agent that inhibits CD47 signaling and the chemotherapeutic agent.

27 . The method of claim 25 , wherein the chemotherapeutic agent comprises an anthracycline or an anthracycline-like agent.

28 . (canceled)

29 . The method of claim 25 , wherein detecting a reduction of cytotoxicity to non-cancer cells in the subject comprises detecting a reduction or inhibition of cardiotoxicity in the subject.

30 . (canceled)

31 . A method of increasing cytotoxicity of a chemotherapeutic agent to cancer cells, comprising administering to a subject with cancer an effective amount of an agent that inhibits CD47 signaling and the chemotherapeutic agent, wherein the agent that inhibits CD47 signaling is administered to the subject before, during, or after administration of the chemotherapeutic agent.

32 - 33 . (canceled)

34 . The method of claim 31 , wherein the chemotherapeutic agent comprises an anthracycline chemotherapeutic agent.

35 . (canceled)

36 . The method of claim 31 , wherein the agent that inhibits CD47 signaling comprises an anti-CD47 antibody or fragment thereof, a CD47-binding peptide, a CD47 antisense oligonucleotide, a CD47 morpholino, an anti-TSP1 antibody or fragment thereof, a TSP1-binding peptide, a TSP1 antisense oligonucleotide, a TSP1 morpholino, a small molecule capable of binding to CD47, or a small molecule capable of binding to TSP1.

37 - 42 . (canceled)

43 . The method of claim 31 , wherein the agent that inhibits CD47 signaling is administered to the subject prior to administration of the chemotherapeutic agent.

44 - 45 . (canceled)

46 . The method of claim 31 , wherein the anti-tumor effects of the chemotherapeutic agent comprise decreasing tumor size, decreasing tumor number, decreasing tumor metastasis, decreasing tumor recurrence, increasing survival, or any combination of two or more thereof.

47 . (canceled)

Assignees

• Us Health

Inventors

• Roberts David D
• Soto Pantoja David R

Classifications

• A61K31/137

  Arylalkylamines, e.g. amphetamine, epinephrine, salbutamol, ephedrine {or methadone} · CPC title

• C07K16/2803

  against the immunoglobulin superfamily · CPC title

• A61K31/437

  the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline · CPC title

• A61K31/706

  containing six-membered rings with nitrogen as a ring hetero atom · CPC title

• A61K39/39558

  against tumor tissues, cells, antigens · CPC title