Application of OBF1 transcription factor in chromosome doubling of plant and transgenic plant cultivation method

Patent metadata

Field	Value
Publication number	US-12522841-B2
Application number	US-202418605899-A
Country	US
Kind code	B2
Filing date	Mar 15, 2024
Priority date	Oct 16, 2023
Publication date	Jan 13, 2026
Grant date	Jan 13, 2026

Abstract

An application of an OBF1 transcription factor in chromosome doubling of a plant and a transgenic plant cultivation method are provided. The gene sequence of the OBF1 transcription factor is shown in SEQ ID NO: 1; and the plant includes petunias, tomatoes, and tobaccos. An OBF1 gene is introduced into plant cells or tissues, and under treatment with kanamycin, a chromosome-doubled transgenic cell line or plant is obtained; and the transgenic plant grows vigorously and exhibits resistance to biotic stress. After treatment according to the present invention, plants still easily self-pollinate, thus enabling efficient separation of doubled offspring plants, and the doubling trait can be stably inherited. This technology overcomes the plant teratogenicity and environmental safety problems faced by the use of prior technologies to double chromosomes in plants, having great significance in cultivating chromosome-doubled plant varieties and being suitable for use in the cultivation and identification of chromosome-doubled varieties.

First claim

What is claimed is:

1 . A method of an application of an OBF1 transcription factor in chromosome doubling of a plant, comprising:
introducing an OBF1 gene into initial plant cells or tissues, under a treatment with kanamycin at a concentration from 100 mg/mL to 150 mg/mL, thereby obtaining a chromosome-doubled transgenic cell line or plant; wherein the gene sequence of the OBF1 transcription factor is shown in SEQ ID NO: 1.

2 . The method of the application of the OBF1 transcription factor in the chromosome doubling of the plant according to claim 1 , wherein an initial plant is a dicotyledonous heterozygote.

3 . The method of the application of the OBF1 transcription factor in the chromosome doubling of the plant according to claim 2 , wherein the initial plant comprises petunias, tomatoes, and tobaccos.

4 . The method of the application of the OBF1 transcription factor in the chromosome doubling of the plant according to claim 3 , wherein the plant is transformed by an OBF1 over-expressing vector, a transformed plant is grown on a medium with the kanamycin, and the transformed plant comprises pollens, cotyledons, hypocotyls, and young leaves of the initial plant.

5 . A method for cultivating an OBF1 transgenic plant, comprising the following steps:
(1) performing primer design on an ORF region of an OBF1 gene to obtain primer pairs OE_F1 and OE_R1; (2) performing a first PCR amplification with the primer pairs OE_F1 and OE_R1, performing cloning to obtain an OBF1 ORF fragment, and constructing the OBF1 ORF fragment into a plant expression vector with kanamycin resistance to obtain recombinant plasmids; (3) mixing 1 μL of the recombinant plasmids with 100 μL of agrobacterium competent cells to obtain a resulting mixture, and transferring the resulting mixture into an electroporation cuvette, performing electroporation transformation by the electroporation cuvette with a voltage of 2510 V, after the electroporation transformation, coating a bacterial liquid onto a Luria-Bertani (LB) solid culture medium containing antibiotics, and performing screening to obtain agrobacterium carrying the recombinant plasmids; (4) performing culture expansion on the agrobacterium carrying the recombinant plasmids on an LB liquid culture medium; (5) infecting juvenile tissues of an initial plant with the agrobacterium after the culture expansion, wherein the juvenile tissues are selected from the group consisting of cotyledons, hypocotyls, young leaves, pollens, and combinations thereof; (6) culturing infected explants with a co-culture culture medium; (7) performing induced differentiation culture on co-cultured explants with a first-generation kanamycin screening culture medium to obtain buds, comprising a kanamycin treatment concentration from 100 mg/mL to 150 mg/ml; (8) cutting out and taking the buds, transferring cut buds to the first-generation kanamycin screening culture medium for further culture, then sequentially transferring cultured buds to a rooting culture medium for rooting culture, and transferring rooting cultured buds into soil for further culture; (9) after seedlings subjected to the further culture in the soil grow stably, taking leaf samples, extracting DNA by a hexadecyl trimethyl ammonium bromide (CTAB) method; performing a second PCR amplification by taking extracted DNA as a template and using primer pairs NPTII_F and NPTII_R, and identifying a plant as a positive transgenic strain, wherein the plant is a TO-generation transgenic strain; (10) before anthers of the TO-generation transgenic strain mature and petals open, performing artificial self-pollination, and performing further culture to obtain seeds; (11) disinfecting the seeds, and further screening disinfected seeds with a second-generation kanamycin resistant culture medium to obtain seedlings growing normally; and (12) transferring the seedlings growing normally into nutritional soil for further culture, to obtain T1-generation homozygous positive transgenic plants, wherein the T1-generation homozygous positive transgenic plants are homozygous chromosome-doubled plants.

6 . The method for cultivating the OBF1 transgenic plant according to claim 5 , wherein the second-generation kanamycin resistant culture, a kanamycin treatment concentration is 15 mg/g-30 mg/g.

7 . The method for cultivating the OBF1 transgenic plant according to claim 5 , wherein the sequences of the primer pairs OE_F1 and OE_R1 used for the first PCR amplification of the OBF1 ORF fragment are shown in SEQ ID NO: 3 and SEQ ID NO: 4,

OE_F1:

ATCTCGAGATGGCATCTTCTAGTGGAAA;

OE_R1:

ATGAGCTCTCAATACTGATAGAACATAT.

8 . The method for cultivating the OBF1 transgenic plant according to claim 5 , wherein the sequences of the primer pairs NPTII_F and NPTII_R are shown in SEQ ID NO: 5 and SEQ ID NO: 6,

NPTII_F:

AAGATGGATTGCACGCAGGT;

NPTII_R:

AGCTTCAAAGCAGATCCAAG.

Assignees

• Jiangsu Acad Agricultural Sci

Inventors

• Wang Hong
• Jiang Caizhong
• Sun Daoyang

Classifications

• C12N15/8205 Primary

  Agrobacterium mediated transformation · CPC title

• C07K14/415

  from plants · CPC title

• C12N15/8261 Primary

  with agronomic (input) traits, e.g. crop yield · CPC title