Virus like particle

Patent metadata

Field	Value
Publication number	US-12209241-B2
Application number	US-201816617098-A
Country	US
Kind code	B2
Filing date	May 31, 2018
Priority date	Jun 1, 2017
Publication date	Jan 28, 2025
Grant date	Jan 28, 2025

Abstract

The disclosure relates to the assembly of Virus Like Particles [VLPs] using packaging native and artificial packaging signals and their use in vaccines and immunological compositions and the methods of vaccination or immunisation against human and animal viral pathogens.

First claim

The invention claimed is:

1. An immunogenic composition comprising:
an adjuvant; and
a virus like particle (VLP) comprising an artificial RNA cassette, wherein the artificial RNA cassette comprises:
one or more packaging signals arranged in series and separated by a non-coding viral nucleic acid, said one or more packaging signals comprising a nucleic acid loop domain comprising a nucleotide binding motif for cognate viral capsid protein(s), and a nucleic acid stem domain comprising a double stranded region by intramolecular base pairing,
wherein:
a) said VLP is a Hepatitis B virus VLP, said one or more packaging signals is from Hepatitis B virus, and said nucleotide binding motif comprises the nucleotide sequence RGAG, wherein R is G or A; or
b) said VLP is a Satellite Tobacco Necrosis Virus VLP, said one or more packaging signals is from Satellite Tobacco Necrosis Virus, and said nucleotide binding motif comprises the nucleotide sequence AXXA or AXXXA, wherein X is any nucleotide base; and
wherein said artificial RNA cassette, when contacted with a plurality of cognate viral capsid proteins, assembles said cognate viral capsid proteins into a VLP that protects said packaging signals contained within said VLP from ribonuclease digestion.

2. The immunogenic composition according to claim 1 , wherein said artificial RNA cassette is non-replicating.

3. The immunogenic composition according to claim 1 , wherein said VLP provokes an immune response similar to an immune response of a native virus particle when administered to an animal subject.

4. The immunogenic composition of claim 1 , wherein said artificial RNA cassette does not comprise a protein-encoding nucleic acid.

5. The immunogenic composition according to claim 1 , wherein said artificial RNA cassette comprises at least 2, at least 3, at least 4 or at least 5 packaging signals.

6. The immunogenic composition according to claim 1 , wherein said non-coding viral nucleic acid separating said one or more packaging signals is at least 5 nucleotides in length.

7. The immunogenic composition according to claim 1 , wherein
said nucleic acid loop domain is at least 4 nucleotides in length;
said nucleic acid stem domain is at least 5 base pairs (bp) in length;
said artificial RNA cassette is at least 50 nucleotides in length; and/or
said artificial RNA cassette is between 50 and 1000 nucleotides in length.

8. The immunogenic composition according to claim 1 , wherein said artificial RNA cassette comprises at least one, two or three packaging signals from Hepatitis B virus, wherein one or more of said at least one, two or three packaging signals from Hepatitis B includes the nucleotide binding motif RGAG.

9. The immunogenic composition according to claim 1 , wherein said artificial RNA cassette comprises at least one Hepatitis B packaging signal, wherein each of said Hepatitis B packaging signals includes the binding motif RGAG.

10. The immunogenic composition according to claim 1 , wherein said artificial RNA cassette comprises:
i) a nucleic acid molecule comprising the nucleotide sequence GUUUGUUUAAAGACUGGGAGGAGUUGGGGGAGGAG, as set forth by SEQ ID NO: 1;
ii) a nucleic acid molecule comprising at least 25% sequence identity to the nucleotide sequence of SEQ ID NO: 1 and comprising the nucleotide binding motif GGGAG;
iii) a nucleic acid molecule comprising the nucleotide sequence GGGCCCUCUGACAGUUAAUGAAAAAAGGAGAUUAAAAUUAAUUAUG CCU, as set forth by SEQ ID NO: 2;
iv) a nucleic acid molecule comprising at least 25% sequence identity to the nucleotide sequence of SEQ ID NO: 2 and comprising the nucleotide binding motif GAAAAAAGGAG;
v) a nucleic acid molecule comprising the nucleotide sequence GGCUGGCAUUCUAUAUAAGAGAGAAACUACACGC, as set forth by SEQ ID NO: 3;
vi) a nucleic acid molecule comprising at least 25% sequence identity to the nucleotide sequence of SEQ ID NO: 3 and comprising the nucleotide binding motif AUAUAAGAG;
vii) a nucleic acid molecule comprising SEQ ID NO: 1;
viii) a nucleic acid molecule comprising SEQ ID NO: 2;
ix) a nucleic acid molecule comprising SEQ ID NO: 3; or
x) a nucleic acid molecule comprising SEQ ID NO: 4.

11. The immunogenic composition according to claim 1 , wherein said artificial RNA cassette comprises a nucleotide sequence selected from the group consisting of:
i) a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 5;
ii) a nucleic acid molecule comprising a nucleotide sequence comprising at least 25% sequence identify to the nucleotide sequence of SEQ ID NO: 5 and comprising the nucleotide binding motif AXXA;
iii) a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 6;
iv) a nucleic acid molecule comprising at least 25% sequence identity to the nucleotide sequence of SEQ ID NO: 6 and comprising the nucleotide binding motif AXXA;
v) a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 7;
vi) a nucleic acid molecule comprising at least 25% sequence identity to the nucleotide sequence of SEQ ID NO: 7 and comprising the nucleotide binding motif AXXA;
vii) a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 8; and
viii) a nucleic acid molecule comprising at least 25% sequence identity to the nucleotide sequence of SEQ ID NO: 8 and comprising the nucleotide binding motif AXXA.

12. The immunogenic composition according to claim 1 , wherein said artificial RNA cassette further comprises a transcription cassette comprising a nucleic acid molecule adapted to transcribe a nucleic acid encoding a polypeptide or a functional RNA.

13. The immunogenic composition according to claim 12 wherein said transcription cassette comprises a promoter sequence and termination sequence to enable expression of said nucleic acid molecule encoding said polypeptide or functional RNA.

14. The immunogenic composition according to claim 13 , wherein said polypeptide is a therapeutic polypeptide.

15. The immunogenic composition according to claim 13 , wherein said functional RNA is an mRNA encoding a therapeutic polypeptide, an antisense oligonucleotide or an siRNA.

16. A method of stimulating an immune response in a subject, comprising administering an effective amount of the immunogenic composition of claim 1 to the subject, thereby stimulating an immune response.

17. The method of claim 16 , wherein
the immune response is induction of an antibody response wherein said antibody response induces antibodies that specifically bind native virus particles; and/or
said virus like particle retains or has enhanced cell tropism when compared to native virus particles.

18. A virus like particle (VLP) comprising:
(i) a non-viral RNA; and
(ii) an artificial RNA cassette, wherein said artificial RNA cassette comprises:
one or more packaging signals arranged in series and separated by a non-coding viral nucleic acid, said one or more packaging signals comprising a nucleic acid loop domain comprising a nucleotide binding motif for cognate viral capsid protein(s), and a nucleic acid stem domain comprising a double stranded region by intramolecular base pairing,
wherein:
a) said VLP is a Hepatitis B virus VLP, said one or more packaging signals is from Hepatitis B virus and said nucleotide binding motif comprises the nucleotide sequence RGAG, wherein R is G or A; or
b) said VLP is a Satellite Tobacco Necrosis Virus VLP, said one or more packaging signals is from Satellite Tobacco Necrosis Virus, and said nucleotide binding motif comprises the nucleotide sequence AXXA or AXXXA, wherein X is any nucleo

Assignees

• The Univ Of Leeds
• Univ York

Inventors

• Leonov German
• White Simon
• Stockley Peter
• Patel Nikesh
• Wroblewski Emma
• Maskell Dan
• Twarock Reidun
• Bingham Richard
• Weiss Eva
• Dykeman Eric

Classifications

• C12N2310/531

  Stem-loop; Hairpin · CPC title

• C12N2310/14

  interfering nucleic acids [NA] · CPC title

• C12N2310/11

  Antisense · CPC title

• C12N15/8283

  for virus resistance · CPC title

• A61K2039/5258

  Virus-like particles · CPC title