RNA-guided human genome engineering

Patent metadata

Field	Value
Publication number	US-12018272-B2
Application number	US-202318296579-A
Country	US
Kind code	B2
Filing date	Apr 6, 2023
Priority date	Dec 17, 2012
Publication date	Jun 25, 2024
Grant date	Jun 25, 2024

Abstract

A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.

First claim

The invention claimed is:

1. An ex vivo human cell comprising:
a Cas9 protein complexed with an RNA,
wherein the RNA comprises the sequence

(SEQ ID NO: 46)

GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC

UUGAAAAAGUGGCACCGAGUCGGUGC.

2. The ex vivo human cell of claim 1 , wherein the Cas9 protein is an S. pyogenes Cas9 protein.

3. The ex vivo human cell of claim 1 , wherein the RNA is about 100 nucleotides in length.

4. The ex vivo human cell of claim 1 , wherein the RNA is complementary to a target nucleic acid sequence within the ex vivo human cell.

5. The ex vivo human cell of claim 4 , wherein the RNA is hybridized to the target nucleic acid sequence in the ex vivo human cell.

6. The ex vivo human cell of claim 1 , wherein the RNA has a secondary structure comprising a first hairpin and a second 3′ hairpin.

7. An ex vivo human cell comprising:
a Cas9 protein complexed with an RNA,
wherein the RNA comprises the sequence

(SEQ ID NO: 46)

GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC

UUGAAAAAGUGGCACCGAGUCGGUGC, 

and

wherein the Cas9 protein bears an SV40 nuclear localization signal.

8. The ex vivo human cell of claim 7 , wherein the SV40 nuclear localization signal is at a C-terminus of the Cas9 protein.

9. The ex vivo human cell of claim 7 , wherein the Cas9 protein is an S. pyogenes Cas9 protein.

10. The ex vivo human cell of claim 7 , wherein the RNA is about 100 nucleotides in length.

11. The ex vivo human cell of claim 7 , wherein the RNA is complementary to a target nucleic acid sequence within the ex vivo human cell.

12. The ex vivo human cell of claim 11 , wherein the RNA is hybridized to the target nucleic acid sequence in the ex vivo human cell.

13. The ex vivo human cell of claim 7 , wherein the RNA has a secondary structure comprising a first hairpin and a second 3′ hairpin.

14. An ex vivo human cell comprising:
a Cas9 protein complexed with an RNA,
wherein:
the RNA comprises the sequence

(SEQ ID NO: 46)

GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC

UUGAAAAAGUGGCACCGAGUCGGUGC, 

and

the RNA is at least 100 nucleotides in length.

15. The ex vivo human cell of claim 14 , wherein the RNA is complementary to a target nucleic acid sequence within the ex vivo human cell.

16. An ex vivo human cell comprising:
an S. pyogenes Cas9 protein complexed with an RNA,
wherein:
the RNA comprises the sequence

(SEQ ID NO: 46)

GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC

UUGAAAAAGUGGCACCGAGUCGGUGC,

the RNA is at least 100 nucleotides in length, and
the S. pyogenes Cas9 protein bears a SV40 nuclear localization signal at a C-terminus of the S. pyogenes Cas9 protein.

17. The ex vivo human cell of claim 16 , wherein the RNA is complementary to a target nucleic acid sequence within the ex vivo human cell.

Assignees

• Harvard College

Inventors

• Church George M
• Mali Prashant G
• Yang Luhan

Classifications

• C12N15/11

  DNA or RNA fragments; Modified forms thereof (DNA or RNA not used in recombinant technology, C07H21/00); {Non-coding nucleic acids having a biological activity} · CPC title

• C12N15/79 Primary

  Vectors or expression systems specially adapted for eukaryotic hosts · CPC title

• C12N15/113

  Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)} · CPC title

• C12N5/10

  Cells modified by introduction of foreign genetic material · CPC title

• C12N15/85 Primary

  for animal cells · CPC title