Compositions and methods for treating hemoglobinopathies

Patent metadata

Field	Value
Publication number	US-12016908-B2
Application number	US-202217815128-A
Country	US
Kind code	B2
Filing date	Jul 26, 2022
Priority date	Feb 13, 2019
Publication date	Jun 25, 2024
Grant date	Jun 25, 2024

Abstract

The present invention features compositions and methods for editing deleterious mutations associated with hemoglobinopathies, such as sickle cell disease (SCD). In particular embodiments, the invention provides methods for correcting mutations in a beta globin polynucleotide using modified adenosine base editors termed “ABE8” having unprecedented levels (e.g., >60-70%) of efficiency.

First claim

What is claimed is:

1. A method of treating sickle cell disease or beta-thalassemia in a subject comprising administering to said subject a cell comprising an edited hemoglobin subunit gamma 1 and/or 2 (HBG1/2) promoter, wherein said edited HBG 1/2 promoter comprises an A to G alteration at position 5 and/or position 8 of the nucleotide sequence of SEQ ID NO: 177, wherein the cell is prepared by contacting the cell with a guide RNA and a base editor comprising a polynucleotide programmable DNA binding domain and an adenosine deaminase domain, wherein the adenosine deaminase domain comprises an arginine (R) or a threonine (T) at amino acid position 147 of the following amino acid sequence, wherein the adenosine deaminase has at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 2, wherein said guide RNA targets said base editor to effect a deamination of a nucleobase of the HBG1/2 promoter in the cell, thereby effecting said A to G alteration at position 5 and/or position 8 of the nucleotide sequence of SEQ ID NO: 177, wherein deamination of the nucleobase of the HBG1/2 promoter in the cell effects an increase in gamma globin (HbF) expression in the subject when administered to said subject as compared to a subject without said cell administered.

2. The method of claim 1 , wherein the cell is a hematopoietic stem cell, a common myeloid progenitor, proerythroblast, erythroblast, reticulocyte, an erythrocyte, or a progenitor of one of the aforementioned cells.

3. The method of claim 1 , wherein the adenosine deaminase domain comprises an arginine (R) at amino acid position 147 of said amino acid sequence.

4. The method of claim 1 , wherein the adenosine deaminase domain comprises a combination of alterations selected from the group consisting of:
Y147T and Q154R;
Y147T and Q154S;
Y147R and Q154S;
Y147R, V82S and Q154S;
Y147T, V82S and Q154S;
V82S and Y147R;
Y147R, V82S and Q154R;
Y147T, V82S and Q154R;
Y147R, V82S and Y123H;
Y147T, V82S and Y123H;
Y147R, I76Y and V82S;
Y147T, I76Y and V82S;
V82S, Y123H, and Y147T;
V82S, Y123H, and Y147R;
Y147R, V82S, Y123H, and Q154R;
Y147T, V82S, Y123H, and Q154R;
Y147R, Q154R, and Y123H;
Y147R, Q154R, and I76Y;
Y147R, Q154R, and T166R;
Y123H, Y147R, Q154R, and I76Y;
V82S, Y123H, Y147R, and Q154R; and
I76Y, V82S, Y123H, Y147R, and Q154R.

5. The method of claim 1 , wherein the adenosine deaminase domain comprises the alterations Y147R, Q154R, and Y123H.

6. The method of claim 1 , wherein the guide RNA comprises the nucleotide sequence CUUGACCAAUAGCCUUGACA (SEQ ID NO: 151).

7. The method of claim 1 , wherein deamination of the nucleobase disrupts repressor binding to the hemoglobin subunit gamma 1 and/or 2 (HBG1/2) promoter.

8. The method of claim 1 , wherein the polynucleotide programmable DNA binding domain comprises a dead Cas9 (dCas9) or a nickase Cas9 (nCas9).

9. A method of treating sickle cell disease or beta-thalassemia in a subject comprising administering to said subject a cell comprising an edited hemoglobin subunit gamma 1 and/or 2 (HBG1/2) promoter, wherein said edited HBG 1/2 promoter comprises an A to G alteration at position 5 and/or position 8 of the nucleotide sequence of SEQ ID NO: 177, wherein the cell is prepared by contacting the cell with a guide RNA comprising the nucleotide sequence of SEQ ID NO: 151 and a base editor comprising a Cas9 nickase domain and an adenosine deaminase domain, wherein the adenosine deaminase domain has at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 2, and wherein the adenosine deaminase domain comprises an arginine (R) at amino acid position 147, an arginine (R) at amino acid position 154, and a histidine at amino acid position 123, or a polynucleotide encoding the base editor, thereby effecting said A to G alteration at position 5 and/or position 8 of the nucleotide sequence of SEQ ID NO: 177, wherein deamination of the nucleobase of the HBG1/2 promoter in the cell effects an increase in gamma globin (HbF) expression in the subject when administered to said subject as compared to a subject without said cell administered.

10. The method of claim 9 , wherein the base editor is ABE8.8-m.

11. The method of claim 9 , wherein the cell is autologous to the subject.

12. The method of claim 11 , wherein the cell is a hematopoietic stem cell.

13. The method of claim 12 , wherein the cell is CD34+.

14. The method of claim 9 , wherein the guide RNA comprises a scaffold comprising the following nucleotide sequence:

(SEQ ID NO: 78)

GUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACU

UGAAAAGUGGCACCGAGUCGGUGCUUUU.

Assignees

• Beam Therapeutics Inc

Inventors

• Slaymaker Ian
• Gaudelli Nicole
• Yu Yi
• Zetsche Bernd
• Born David A
• Lee Seung-Joo
• Packer Michael

Classifications

• C07K2319/00

  Fusion polypeptide · CPC title

• C12N2310/315

  Phosphorothioates · CPC title

• C12N2310/321

  2'-O-R Modification · CPC title

• C12N15/113

  Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)} · CPC title

• C12N9/22

  Ribonucleases {[RNase]; Deoxyribonucleases [DNase]} · CPC title