Methods for screening solid tumors for mutations
US-10689710-B2 · Jun 23, 2020 · US
US11981966B2 · US · B2
| Field | Value |
|---|---|
| Publication number | US-11981966-B2 |
| Application number | US-202016870033-A |
| Country | US |
| Kind code | B2 |
| Filing date | May 8, 2020 |
| Priority date | May 27, 2015 |
| Publication date | May 14, 2024 |
| Grant date | May 14, 2024 |
A practical reading order for non-experts. Skip the full description unless you need deep technical detail.
What the patent document calls the invention.
A short plain-language summary of the technical disclosure.
Who owns or filed the patent and who is credited as inventor.
Filing, priority, publication, and grant dates set the timeline.
The legal scope of protection — read this for what is actually claimed.
Technology tags used to group this patent with similar filings.
Prior art links and similar publications in this corpus.
Official abstract text for this publication.
The present technology relates to methods for determining whether a patient diagnosed with breast cancer, colorectal cancer, melanoma or lung cancer will benefit from or is predicted to be responsive to treatment with an individual therapeutic agent or a specific combination of therapeutic agents. These methods are based on screening a patient's solid tumors and detecting alterations in target nucleic acid sequences corresponding to a specific set of cancer-related genes. Kits for use in practicing the methods are also provided.
Opening claim text (preview).
The invention claimed is: 1. A method for detecting at least one mutation in a plurality of cancer-related genes in a subject diagnosed with breast cancer or colorectal cancer comprising: (a) extracting genomic DNA from a formalin fixed paraffin-embedded specimen obtained from the subject; (b) generating a library comprising amplicons corresponding to each of a plurality of cancer-related genes, said plurality of cancer-related genes comprising AKT1, ERBB2, FOXL2, IDH2, NRAS, RET, ALK, ERBB4, GNA11, KIT, PDGFRA, SMO, BRAF, FBXW7, GNAQ, KRAS, PIK3CA, STK11, CTNNB1, FGFR2, GNAS, MAP2K1, PIK3R1, TP53, DDR2, FGFR3, HRAS, MET, PTCH1, EGFR, FGFR4, IDH1, NOTCH1, and PTEN, wherein the amplicons are generated in a multiplex amplification reaction using primer pairs specific for each of the cancer related genes and wherein at least two of the primer pairs are selected from the group consisting of the primers of SEQ ID NOS: 1-18, 45-54, and 71-274 or the group consisting of the primers of SEQ IN NOS: 19-44, 55-70, and 275-464, wherein: (i) generating the library proceeds independently of using a bait set comprising nucleic acid sequences that are complementary to at least one of the plurality of amplicons, and (ii) the quality of the genomic DNA extracted from the formalin fixed paraffin-embedded specimen is not assessed using quantitative PCR prior to generating the library; (c) detecting at least one mutation in at least one of the amplicons using high throughput massive parallel sequencing. 2. The method of claim 1 , wherein the amplicons corresponding to PIK3CA are generated by a pair of primers selected from the group consisting of 5′ CCTAGTAGAATGTTTACTACCAA 3′ (SEQ ID NO.: 1) and 5′ CTGCTTCTTGAGTAACACTT 3′ (SEQ ID NO.: 2); 5′ CATGTTCATGCTGTGTATGT 3′ (SEQ ID NO.: 3) and 5′ GCTTCTTTACAAACGTTCAGAA 3′ (SEQ ID NO.: 4); 5′ TCTATGTTCGAACAGGTATCT 3′ (SEQ ID NO.: 5) and 5′ ACTGCTAAACACTAATATAACCTTTG 3′ (SEQ ID NO.: 6); 5′ TTGAAATGTGTTTTATAATTTAGACTAGT 3′ (SEQ ID NO.: 7) and 5′ CCATGAGGTACTGGCC 3′ (SEQ ID NO.: 8); 5′ TTGGTGTTACTGGATCAAATC 3′ (SEQ ID NO.: 9) and 5′ TGCTGAACCAGTCAAACT 3′ (SEQ ID NO.: 10); 5′ TATTATTTTATTTTACAGAGTAACAGACTAG 3′ (SEQ ID NO.: 11) and 5′ TTTAGCACTTACCTGTGACT 3′ (SEQ ID NO.: 12); 5′ TGGAATGCCAGAACTACA 3′ (SEQ ID NO.: 13) and 5′ GTGGAAGATCCAATCCATTTT 3′ (SEQ ID NO.: 14); 5′ GGAATGAATGGCTGAATTATG 3′ (SEQ ID NO.: 15) and 5′ GCGGTATAATCAGGAGTTTT 3′ (SEQ ID NO.: 16); 5′ AGTTGGCCTGAATCACTATA 3′ (SEQ ID NO.: 17) and 5′ GATGTTACTATTGTGACGATCTC 3′ (SEQ ID NO.: 18); 5′ GTAAGTGTTACTCAAGAAGC 3′ (SEQ ID NO.: 19) and 5′ ATAGGATATTGTATCATACCAATTTCT 3′ (SEQ ID NO.: 20); 5′ TCCACAGCTACACCATATAT 3′ (SEQ ID NO.: 21) and 5′ AGCATCAGCATTTGACTTTA 3′ (SEQ ID NO.: 22); 5′ TACACAGACACTCTAGTATCTG 3′ (SEQ ID NO.: 23) and 5′ GAAGGTTTGACTGCCATAAA 3′ (SEQ ID NO.: 24); 5′ ATGACAAAGAACAGCTCAAA 3′ (SEQ ID NO.: 25) and 5′ GAGATCAGCCAAATTCAGTT 3′ (SEQ ID NO.: 26); 5′ GATGTGTTACAAGGCTTATCTA 3′ (SEQ ID NO.: 27) and 5′ GCCTCTTGCTCAGTTTTATC 3′ (SEQ ID NO.: 28); 5′ GAGGCTTTGGAGTATTTCA 3′ (SEQ ID NO.: 29) and 5′ CTGCTGAGAGTTATTAACAGT 3′ (SEQ ID NO.: 30); and 5′ GCTTTTGGAGTCCTATTGT 3′ (SEQ ID NO.: 31) and 5′ CACAAACTAGAGTCACACAC 3′ (SEQ ID NO.: 32). 3. The method of claim 1 , wherein the amplicons corresponding to PIK3R1 are generated by a pair of primers selected from the group consisting of 5′ GGGTTTTGGGCTGATATTA 3′ (SEQ ID NO.: 33) and 5′ CCACAGAACTGAAGGTTAAT 3′ (SEQ ID NO.: 34); 5′ TTATCCATTGAATTTATTTTAATCTTTCTAG 3′ (SEQ ID NO.: 35) and 5′ GGGATGTGCGGGTATATT 3′ (SEQ ID NO.: 36); 5′ GTCTTGCAGTAAGAGATTGT 3′ (SEQ ID NO.: 37) and 5′ TCTTTGCTGTACCGCT 3′ (SEQ ID NO.: 38); 5′ GTTTCTTTTGCCTGCA 3′ (SEQ ID NO.: 39) and 5′ TGGATAAGGTCTGGTTTAATG 3′ (SEQ ID NO.: 40); 5′ GCTACAATTCAGGATGAGTTA 3′ (SEQ ID NO.: 41) and 5′ TCTTCTGCTATCACCATCTTT 3′ (SEQ ID NO.: 42); 5′ CCATCATGATGAGAAGACAT 3′ (SEQ ID NO.: 43) and 5′ TTGCTGGAGATACATACACT 3′ (SEQ ID NO.: 44); 5′ GTGGTCACTAAACCTTAAGA 3′ (SEQ ID NO.: 45) and 5′ GGCTTACCTTAGTGTAAGAG 3′ (SEQ ID NO.: 46); 5′ TTTCATCGAGATGGGAAATATG 3′ (SEQ ID NO.: 47) and 5′ ACCTGTTGGTATTTGGATACT 3′ (SEQ ID NO.: 48); 5′ AGAAGATAATATTGAAGCTGTAGG 3′ (SEQ ID NO.: 49) and 5′ AGAACTCTTATTTTTTAATCTGATTTTCA 3′ (SEQ ID NO.: 50); 5′ GGACAGCTATTGAAGCATTTA 3′ (SEQ ID NO.: 51) and 5′ CACAAGAACAAGGGAAACAC 3′ (SEQ ID NO.: 52); 5′ GCAGGCAGCTGAGTATC 3′ (SEQ ID NO.: 53) and 5′ TCATCCTGAATTGTAGCAATCA 3′ (SEQ ID NO.: 54). 4. The method of claim 1 , wherein the amplicons corresponding to PTEN are generated by a pair of primers selected from the group consisting of 5′ CAGCTTCTGCCATCTCT 3′ (SEQ ID NO.: 55) and 5′ AGCAGCCGCAGAAAT 3′ (SEQ ID NO.: 56); 5′ GTGGCTTTTTGTTTGTTTG 3′ (SEQ ID NO.: 57) and 5′ CACTCTAACAAGCAGATAACT 3′ (SEQ ID NO.: 58); 5′ TACTTGTTAATTAAAAATTCAAGAGTTTT 3′ (SEQ ID NO.: 59) and 5′ CTTAGCCATTGGTCAAGATC 3′ (SEQ ID NO.: 60); 5′ ACAATCATGTTGCAGCA 3′ (SEQ ID NO.: 61) and 5′ AAAAACATCAAAAAATAACTTACCTTTT 3′ (SEQ ID NO.: 62); 5′ AGAGGCGCTATGTGTATTA 3′ (SEQ ID NO.: 63) and 5′ CATGGAAGGATGAGAATTTCA 3′ (SEQ ID NO.: 64); 5′ GGAAGACAAGTTCATGTACT 3′ (SEQ ID NO.: 65) and 5′ CTGTCCTTATTTTGGATATTTCTC 3′ (SEQ ID NO.: 66); 5′ ATTAATTAAATATGTCATTTCATTTCTTTTTC 3′ (SEQ ID NO.: 67) and 5′ GCTATCGATTTCTTGATCACA 3′ (SEQ ID NO.: 68); 5′ TGAGTCATATTTGTGGGTTTTC 3′ (SEQ ID NO.: 69) and 5′ TGATCAGGTTCATTGTCACTAA 3′ (SEQ ID NO.: 70); 5′ TTTGATTGCTGCATATTTCAG 3′ (SEQ ID NO.: 71) and 5′ TCAAAGCATTCTTACCTTACTAC 3′ (SEQ ID NO.: 72); 5′ TTTTAAACTTTTCTTTTAGTTGTGC 3′ (SEQ ID NO.: 73) and 5′ ACTCGATAATCTGGATGACT 3′ (SEQ ID NO.: 74); 5′ CAATTTAGTGAAATAACTATAATGGAAC 3′ (SEQ ID NO.: 75) and 5′ AGTGCCACTGGTCTATAAT 3′ (SEQ ID NO.: 76); 5′ CCTGTGAAATAATACTGGTATGT 3′ (SEQ ID NO.: 77) and 5′ CTACTTTGATATCACCACACAC 3′ (SEQ ID NO.: 78); 5′ TAGAGCGTGCAGATAATGA 3′ (SEQ ID NO.: 79) and 5′ TCAACAACCCCCACAAA 3′ (SEQ ID NO.: 80); and 5′ CTTTCTCTAGGTGAAGCTGTA 3′ (SEQ ID NO.: 81) and 5′ GGTTCATTCTCTGGATCAGA 3′ (SEQ ID NO.: 82). 5. The method of claim 1 , wherein the formalin fixed paraffin-embedded specimen is a heterogeneous tumor. 6. The method of claim 5 , wherein 5%-10% of the cells of the heterogeneous tumor harbor at least one mutation in at least one of the plurality of amplicons. 7. The method of claim 5 , wherein at least 10% of the cells of the heterogeneous tumor harbor at least one mutation in at least one of the plurality of amplicons. 8. The method of claim 1 , wherein the breast cancer is HER-2 negative breast cancer. 9. The method of claim 1 , wherein the library comprising amplicons corresponding to each of the plurality of cancer-related genes is generated using no more than 10 ng of extracted genomic DNA from the formalin fixed paraffin-embedded tumor sample. 10. The method of claim 1 , further comprising: (d) detecting at least one mutation in at least one of the amplicons corresponding to the plurality of cancer-related genes. 11. The method of claim 10 , wherein the at least one mutation is in at least one of the amplicons corresponding to PIK3CA, PIK3R1, PTEN, NOTCH1, ERBB2, BRAF, PTCH1, SMO, EGFR, KRAS, DDR2, MAP2K1, FGFR3, NRAS, MET and FBXW7. 12. The method of claim 11 , wherein the subject has breast cancer and at least one mutation in at least one of the amplicons corresponding to PIK3CA, PIK3R1, and PTEN.
for cancer (immunoassay for cancer G01N33/575) · CPC title
Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism · CPC title
Polymorphic or mutational markers · CPC title
Primer sets for multiplex assays · CPC title
Related publications grouped by family.
Answers are generated from the same data shown on this page.