Compositions and methods for treating RSV-infections

Patent metadata

Field	Value
Publication number	US-11911481-B2
Application number	US-201917057153-A
Country	US
Kind code	B2
Filing date	May 21, 2019
Priority date	May 21, 2018
Publication date	Feb 27, 2024
Grant date	Feb 27, 2024

Abstract

This invention provides for a RSV-targeted nanoparticle PMN (RTPMN), combining HR2D anti-fusion peptide, and plasmid encoded siRNA against RSV-NS1 and/or RSV-P gene as a safe, effective and inexpensive anti-RSV prophylaxis and/or therapy.

First claim

What is claimed is:

1. A nanoparticle, comprising:
(a) first layer comprising chitosan and a heptad repeat (HR)2 peptide;
(b) a second layer comprising a plurality of phospholipids forming a lipid bilayer; and
(c) a third layer comprising chitosan, and a vector comprising a nucleic acid;
wherein the second layer is between the first layer and the third layer; wherein the first layer comprises an outer coat of the nanoparticle; and the third layer comprises an inner core of the nanoparticle.

2. The nanoparticle of claim 1 , wherein the nucleic acid is small interfering RNA (siRNA) or short hairpin RNA (shRNA).

3. The nanoparticle of claim 1 , wherein the vector is a dual expressing short hairpin RNA (shRNA) recombinant plasmid DNA.

4. The nanoparticle of claim 1 , wherein the vector comprises a short hairpin RNA (shRNA) specific to respiratory syncytial virus's (RSV) non-structural 1 protein.

5. The nanoparticle of claim 1 , wherein the vector comprises a short hairpin RNA (shRNA) specific to a respiratory syncytial virus (RSV) phosphoprotein.

6. The nanoparticle of claim 1 , wherein the vector comprises a short hairpin RNA (shRNA) specific to respiratory syncytial virus's (RSV) non-structural 1 protein and an shRNA specific to a RSV phosphoprotein.

7. The nanoparticle of claim 1 , wherein the first layer further comprises a targeting moiety.

8. The nanoparticle of claim 7 , wherein the targeting moiety is an anti-ICAM antibody.

9. The nanoparticle of claim 2 , wherein the siRNA or the shRNA is directed against respiratory syncytial virus (RSV) non-structural 1 protein (NS1) or RSV phosphoprotein (P).

10. The nanoparticle of claim 2 , wherein the shRNA comprises: 5′-

(NSla; SEQ ID NO: 9)

AGCAGCAATTCATTGAGTATGCTAGTGAAGCCACAGATGTAGCATACTCA

ATGAATTGCTGCC-3′;

5′-

(NS1b; SEQ ID NO: 10)

ATGCATGTTATTACAAGTAGTTTAGTGAAGCCACAGATGTAAACTACTTG

TAATAACATGCAC-3′;

5′-

(Pa; SEQ ID NO: 11)

AGATAATATAACAGCAAGATTTAGTGAAGCCACAGATGTAAATCTTGCTG

TTATATTATCG-3′;

or
5′-

(Pb; SEQ ID NO: 12)

ACAGGGAACAAGCCCAATTATTTAGTGAAGCCACAGATGTAAATAATTGG

GCTTGTTCCCTGC-3′.

11. The nanoparticle of claim 2 , wherein the siRNA or the shRNA inhibits the expression of a gene that encodes respiratory syncytial virus (RSV) non-structural 1 protein (NS1) and phosphoprotein (P).

12. The nanoparticle of claim 2 , wherein the shRNA is directed against a sequence selected from one or more of the sequences of 5′-

(SEQ ID NO: 7)

CTGCTGTTGACAGTGAGCGAGGCAGCAATTCATTGAGTATGCTTGTGAAG

CCACAGATGAAGCATACTCAATGAATTGCTGCCCTGCCTACTGCCTCGGA

CTTCAAGGG-3′

and 5′-

(SEQ ID NO: 8)

CTGCAGTGCTGTTGACAGTGAGCGACGATAATATAACAGCAAGATTGTGA

AGCCACAGATGAATCTTGCTGTTATATTATCGCTGCCTACTGCCTCGGAC

TTCAAGGCTGCA-3′.

13. The nanoparticle of claim 1 , wherein the HR2 peptide consists of SEQ ID NO: 6.

14. The nanoparticle of claim 1 , wherein the chitosan is ionically bonded to the HR2 peptide.

15. The nanoparticle of claim 1 , wherein the ratio of the chitosan to the short hairpin RNA (shRNA) is about 2 to about 10.

16. The nanoparticle of claim 1 , wherein the ratio of the chitosan to the short hairpin RNA (shRNA) is about 2, 5 or 7.

17. The nanoparticle of claim 1 , wherein the nanoparticle is formulated for intravenous administration, intratracheal administration, intramuscular administration, subcutaneous administration, intranasal administration, oral administration, by inhalation or for direct injection or intravenous perfusion.

18. A pharmaceutical composition comprising a nanoparticle of claim 1 and a pharmaceutically acceptable carrier.

19. A method of delivering a nucleic acid to a subject, the method comprising administering to the subject an effective amount of a pharmaceutical composition comprising a nanoparticle of claim 1 .

20. A method of treating or preventing a respiratory syncytial virus (RSV) infection in a subject, the method comprising administering to the subject an effective amount of a pharmaceutical composition comprising a nanoparticle of claim 1 .

21. The method of claim 20 , further comprising identifying a subject in need thereof.

22. The method of claim 20 , wherein the subject is a human.

23. The method of claim 20 , wherein the subject has RSV.

24. The method of claim 20 , wherein the composition is administered to the subject intranasally, intravenously, by injection or orally.

25. The method of claim 20 , further comprising administering ribavirin, palivizumab, a corticosteroid, an antibiotic or a combination thereof.

26. A method of inhibiting respiratory syncytial virus (RSV) replication by disrupting, impairing and/or displacing the non-structural 1 protein (NS1) - phosphoprotein (P) interaction, the method comprising contacting the nanoparticle of claim 1 with a cell.

27. A pharmaceutically acceptable vaccine composition comprising the nanoparticle of claim 1 , wherein the nucleic acid is capable of eliciting an immune response in a host.

28. A method of vaccinating a mammal against a viral infection, the method comprising administering a nanoparticle

Assignees

• Us Gov Veterans Affairs
• Univ South Florida

Inventors

• Markoutsa Eleni
• Mohapatra Subhra
• Mohapatra Shyam

Classifications

• A61K47/544 Primary

  Phospholipids · CPC title

• A61K39/12

  Viral antigens · CPC title

• A61K45/06

  Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca · CPC title

• A61K47/6939

  the polymer being a polysaccharide, e.g. starch, chitosan, chitin, cellulose or pectin · CPC title

• B82Y5/00

  Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery · CPC title