Encoding genes of nitrilase mutants and application thereof

Patent metadata

Field	Value
Publication number	US-11535839-B2
Application number	US-202117165153-A
Country	US
Kind code	B2
Filing date	Feb 2, 2021
Priority date	Feb 14, 2018
Publication date	Dec 27, 2022
Grant date	Dec 27, 2022

Abstract

The present invention discloses encoding genes of nitrilase mutants and application thereof. The nucleotide sequence of the gene is shown in SEQ ID No.5, and the amino acid sequence of the mutant is shown in SEQ ID No.6. In the present invention, by the protein molecular modification, thermostability of the purified nitrilase LNIT5 is increased by up to 4.5 folds; and by utilizing recombinant E. coli containing the nitrilase mutant to hydrolyze 1-cyanocyclohexylacetonitrile at a high temperature, product tolerance is increased, activity of NIT5-L201F is increased by 20%, and the mutant NITLNIT5-AcN can completely hydrolyze 750 mM 1-cyanocyclohexylacetonitrile within 8 hours and achieve an doubled conversion rate. Therefore, the mutants obtained by the present invention have a good application prospect in efficiently catalyzing 1-cyanocyclohexylacetonitrile to synthesize gabapentin intermediate, 1-cyanocyclohexyl acetic acid.

First claim

The invention claimed is:

1. An encoding gene of a nitrilase mutant, having the nucleotide sequence of SEQ ID No.5.

2. The encoding gene of a nitrilase mutant as claimed in claim 1 , wherein the translated nitrilase mutant has the amino acid sequence of SEQ ID No.6.

3. The encoding gene of a nitrilase mutant as claimed in claim 1 , wherein the gene is derived from A. facilis CCTCC NO: M 209044 (GenBank Accession no. KJ001820) having nucleotide sequence of SEQ ID No.7.

4. The encoding gene of a nitrilase mutant as claimed in claim 1 , wherein the gene is obtained as follows: firstly, design primers, use PCR amplification to obtain a nucleotide sequence that contains homologous arms and the nucleotide sequence translating to amino acids at positions 324-371 of the nitrilase derived from A. facilis CCTCC NO: M 209044 (GenBank Accession no. KJ001820) having the nucleotide sequence of SEQ ID No.7; then, design primers, use PCR amplification to obtain a linearized vector sequence containing homologous arms and the nucleotide sequence translating to amino acids at region 1-323 of the nitrilase amino acid sequence (GenBank Accession no: AAR97494.1) having the amino acid sequence of SEQ ID No.2; fuse the two nucleotide sequences via homologous recombination to obtain the nucleotide sequence which is translated to the amino acid sequence the nitrilase mutant.

5. The encoding gene of a nitrilase mutant as claimed in claim 4 , wherein the nucleotide sequence translating to amino acids at positions 324-371 is shown in SEQ ID No.7.

6. The encoding gene of a nitrilase mutant as claimed in claim 4 , wherein design primers I-f and I-r having the nucleotide sequences of SEQ ID No.11 and SEQ ID NO. 12, use PCR amplification to obtain a nucleotide sequence that contains homologous arms and the nucleotide sequence translating to amino acids at positions 324-371 of the nitrilase derived from A. facilis CCTCC NO: M 209044 (GenBank Accession no. KJ001820) having the nucleotide sequence of SEQ ID No.7;

primer name
primer sequence (5′ to 3′)

I-f
ACCTGGACGAAGAAGGTCGTCTGGATGTTAACACGC

GTTCC

I-r
TTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGG

TGC.

7. The encoding gene of a nitrilase mutant as claimed in claim 4 , wherein design primers P-f and P-r having the nucleotide sequences of SEQ ID No.13 and SEQ ID NO. 14, use PCR amplification to obtain a linearized vector sequence containing homologous arms and the nucleotide sequence translating to amino acids at region 1-323 of the nitrilase amino acid sequence (GenBank Accession no: AAR97494.1) having the amino acid sequence of SEQ ID No.2;

primer name
primer sequence (5′ to 3′)

P-f
TGAGATCCGGCTGCTAACAAA

P-r
ACGACCTTCTTCGTCCAGGTAA.

Assignees

• Univ Zhejiang Technology

Inventors

• Xue Yaping
• Zheng Yuguo
• Xu Zhe
• Liu Zhiqiang

Classifications

• C12N9/78 Primary

  acting on carbon to nitrogen bonds other than peptide bonds (3.5) · CPC title

• C12P13/002

  Nitriles (-CN) · CPC title

• C12Y305/05001

  Nitrilase (3.5.5.1) · CPC title

• C12N15/63

  Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression · CPC title