Recombinant vector constructed from an encoding gene of a nitrilase mutant, a recombinant genetic engineered strain and application thereof

Patent metadata

Field	Value
Publication number	US-11525131-B2
Application number	US-202117165319-A
Country	US
Kind code	B2
Filing date	Feb 2, 2021
Priority date	Feb 14, 2018
Publication date	Dec 13, 2022
Grant date	Dec 13, 2022

Abstract

The present invention discloses a recombinant vector constructed from an encoding gene of a nitrilase mutant, a recombinant genetic engineered strain and application thereof the nucleotide sequence of the gene is shown in SEQ ID No. 5, and the amino acid sequence of the mutant is shown in SEQ ID No. 6. In the present invention, by the protein molecular modification, thermostability of the purified nitrilase LNIT5 is increased by up to 4.5 folds; and by utilizing recombinant E. coli containing the nitrilase mutant to hydrolyze 1-cyanocyclohexylacetonitrile at a high temperature (45° C.), product tolerance is increased, activity of NITS-L201F is increased by 20%, and the mutant NITLNIT5-AcN can completely hydrolyze 750 mM 1-cyanocyclohexylacetonitrile within 8 hours and achieve an doubled conversion rate. Therefore, the mutants obtained by the present invention have a good application prospect in efficiently catalyzing 1-cyanocyclohexylacetonitrile to synthesize gabapentin intermediate, 1-cyanocyclohexyl acetic acid.

First claim

The invention claimed is:

1. A recombinant vector constructed from comprising an encoding gene of a nitrilase mutant, wherein the nucleotide sequence of the gene is shown in SEQ ID No:5.

2. The recombinant vector as claimed in claim 1 , wherein the amino acid sequence of the mutant is shown in SEQ ID No:6.

3. The recombinant vector as claimed in claim 1 , wherein the gene has the nucleotide sequence set forth in SEQ ID No:7.

4. The recombinant vector as claimed in claim 3 , wherein the gene is obtained as follows: firstly, designing primers, using PCR amplification to obtain a nucleotide sequence that contains homologous arms and the nucleotide sequence of SEQ ID No:7; then, designing primers, using PCR amplification to obtain a linearized vector sequence containing homologous arms and the nucleotide sequence corresponding to the amino acids at region 1-323 of the nitrilase amino acid sequence set forth in SEQ ID NO:2 derived from an uncultured microorganism; fusing the two nucleotide sequences via homologous recombination to obtain the amino acid sequence of the nitrilase mutant.

5. The recombinant vector as claimed in claim 4 , wherein the nucleotide sequence coding the amino acids at positions 324-371 is shown in SEQ ID No:7.

6. The recombinant vector as claimed in claim 4 , wherein obtaining the gene further comprises designing primers I-f and I-r, using PCR amplification to obtain a nucleotide sequence that contains homologous arms and the nucleotide sequence of SEQ ID No:7;

primer

name
primer sequence (5′ to 3′)

I-f
ACCTGGACGAAGAAGGTCGTCTGGATGTTAACACGCGTTCC

I-r
TTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTGC

7. The recombinant vector as claimed in claim 4 , wherein obtaining the gene further comprises designing primers P-f and P-r, using PCR amplification to obtain a linearized vector sequence containing homologous arms and the nucleotide sequence corresponding to amino acids at region 1-323 of the nitrilase amino acid sequence set forth in SEQ ID NO:2;

primer

name
primer sequence (5′ to 3′)

P-f
TGAGATCCGGCTGCTAACAAA

P-r
ACGACCTTCTTCGTCCAGGTAA

8. The recombinant vector as claimed in claim 1 , wherein the gene is ligated to an expression vector pET-28b(+) by enzymatic cutting and ligating to construct a recombinant vector pET-28b(+)-LNIT5.

9. A recombinant genetically engineered strain transformed by with the recombinant vector as claimed in claim 1 .

10. The recombinant genetically engineered strain as claimed in claim 9 , wherein the recombinant genetically engineered strain is obtained by transforming the recombinant vector into a host cell, wherein the host cell is E. coli BL21 (DE3).

Assignees

• Univ Zhejiang Technology

Inventors

• Xue Yaping
• Zheng Yuguo
• Xu Zhe
• Liu Zhiqiang

Classifications

• C12N15/63

  Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression · CPC title

• C12N9/78 Primary

  acting on carbon to nitrogen bonds other than peptide bonds (3.5) · CPC title

• C12P13/002

  Nitriles (-CN) · CPC title

• C12Y305/05001

  Nitrilase (3.5.5.1) · CPC title