Gamma herpesvirus circular RNA

Patent metadata

Field	Value
Publication number	US-11512357-B2
Application number	US-201917059949-A
Country	US
Kind code	B2
Filing date	May 31, 2019
Priority date	Jun 1, 2018
Publication date	Nov 29, 2022
Grant date	Nov 29, 2022

Abstract

In an embodiment, the invention provides a method and reagents for detection of γ-herpesvirus circRNA. In another embodiment, the invention provides a method and reagents for detection of EBV circRNA. In still another embodiment, the invention provides a method and reagents for detection of KSHV circRNA. The method can be expanded to other herpesviruses and even non-herpesviruses that generate circRNA upon cellular infection.

First claim

The invention claimed is:

1. A method of preparing a sample of specifically hybridized γ-herpesvirus circRNA, the method comprising:
obtaining a tissue or fluid sample from a subject and
specifically hybridizing one or more oligonucleotides to γ-herpesvirus circRNA (i) in the tissue or fluid sample from the subject or (ii) extracted from the tissue or fluid sample from the subject, thereby preparing a sample of specifically hybridized γ-herpesvirus circRNA.

2. The method of claim 1 , wherein RNA is extracted from the tissue sample.

3. The method of claim 1 , wherein the one or more oligonucleotides are specifically hybridized to γ-herpesvirus circRNA in situ.

4. The method of claim 1 , wherein prior to specifically hybridizing the one or more oligonucleotides to the y-herpesvirus circRNA, the tissue or fluid sample, or RNA extracted therefrom, is first subjected to treatment with an RNAse.

5. The method of claim 1 , wherein specifically hybridizing the one or more oligonucleotides to the γ-herpesvirus circRNA comprises rtPCR.

6. The method of claim 1 , wherein the γ-herpesvirus is Epstein-Barr Virus (EBV).

7. The method of claim 1 , wherein the γ-herpesvirus is Kaposi's Sarcoma-Associated Herpesvirus (KSHV).

8. A method comprising obtaining a tissue or fluid sample from a subject and assaying the tissue or fluid sample to determine the presence of y-herpesvirus circRNA,
wherein the method for detecting the presence of y-herpesvirus circRNA is rtPCR,
wherein the rtPCR employs, as primer pairs, oligonucleotides having the following sequences: (a) DP1-R (reverse): CGCCCGTATTCACACATTCC (SEQ ID NO:1) and DP1-F (forward): GACGCTAGTGCTGCATGGG (SEQ ID NO:2), (b) DP2-F (forward): TGAGGAATACCTCGTTGTCTTCCG (SEQ ID NO:3) and DP2-R (reverse):
AGCCCTTCTTCGTTATGCAC (SEQ ID NO:4) or (c) circvIRF4-R (reverse):
CAAATGCATGGTACACCGAATAC (SEQ ID NO:5) and circvIRF4-F (forward):
GAACCGCTATTACAATGTTGGC (SEQ ID NO:6).

9. A method of preparing a sample of specifically hybridized viral circRNA from a double-stranded DNA virus, the method comprising;
obtaining a tissue or fluid sample from a mammalian subject; and
specifically hybridizing one or more oligonucleotides to viral circRNA from a double- stranded DNA virus (i) in the tissue or fluid sample from the subject or (ii) extracted from the tissue or fluid sample from the subject, thereby preparing a sample of specifically hybridized viral circRNA from a double-stranded DNA virus.

10. The method of claim 9 , wherein RNA is extracted from the tissue sample.

11. The method of claim 9 , which distinguishes between viral circRNA and linear viral RNA.

12. The method of claim 9 , which involves pretreatment of the tissue or fluid sample, or extracted RNA, with RNAse R.

13. The method of claim 9 , which comprises using divergent reverse transcription PCR (rtPCR).

14. A method of determining the presence of γ-herpesvirus circRNA in a subject and treating a condition associated with y-herpesvirus infection in the subject, the method comprising:
receiving an identification of a subject as having γ-herpesvirus circRNA in a tissue or fluid sample from the subject, wherein γ-herpesvirus circRNA has been detected by a method comprising obtaining a tissue or fluid sample from the subject and assaying the tissue or fluid sample to determine the presence of γ-herpesvirus circRNA; and
administering an oligonucleotide to the subject identified as having γ-herpesvirus circRNA in the tissue or fluid sample from the subject, wherein the oligonucleotide that hybridizes to the BART small junction (Si) sequence (TCGACGGGCAAGGTCCGGCGTGTC (SEQ ID NO:7)), the BART large junction (LI) sequence (TCGACGGGCAAGATGCCATTGGGC (SEQ ID NO:8)), or the RF junction sequence (CATCTACCTCAGCCCCCGCGCCCC (SEQ ID NO:13).

15. The method of claim 14 , wherein RNA is extracted from the tissue sample, and then the extracted RNA is assayed to determine the presence of γ-herpesvirus circRNA.

16. The method of claim 14 , wherein the fluid sample or tissue is assayed to determine the presence of y-herpesvirus circRNA in situ.

17. The method of claim 14 , wherein prior to assaying the tissue or fluid sample or RNA extracted therefrom to determine the presence of γ-herpesvirus circRNA, the tissue or fluid sample, or RNA extracted therefrom, is first subjected to treatment with an RNAse.

18. The method of claim 14 , wherein the method for detecting the presence of γ-herpesvirus circRNA is rtPCR.

19. The method of claim 14 , wherein the y-herpesvirus is Epstein-Barr Virus (EBV).

20. The method of claim 14 , wherein the y-herpesvirus is Kaposi's Sarcoma-Associated Herpesvirus (KSHV).

21. The method of claim 18 , wherein the rtPCR employs, as primer pairs, oligonucleotides having the following sequences: (a) DP1-R (reverse):
CGCCCGTATTCACACATTCC (SEQ ID NO:1) and DP1-F (forward):
GACGCTAGTGCTGCATGGG (SEQ ID NO:2), (b) DP2-F (forward):
TGAGGAATACCTCGTTGTCTTCCG (SEQ ID NO:3) and DP2-R (reverse):
AGCCCTTCTTCGTTATGCAC (SEQ ID NO:4) or (c) circvIRF4-R (reverse):
CAAATGCATGGTACACCGAATAC (SEQ ID NO:5) and circvIRF4-F (forward):
GAACCGCTATTACAATGTTGGC (SEQ ID NO:6).

22. The method of claim 8 , wherein the γ-herpesvirus is Epstein-Barr Virus (EBV).

Assignees

• Univ Of Pittsburgh—Of The Commonwealth System Of Higher Education

Inventors

• Moore Patrick S
• Toptan Tuna
• Chang Yuan

Classifications

• C12N2310/11

  Antisense · CPC title

• C12N15/1133

  against herpetoviridae, e.g. HSV · CPC title

• C12N15/63

  Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression · CPC title

• C12N15/09

  Recombinant DNA-technology · CPC title

• C12N2310/341

  Gapmers, i.e. of the type ===---=== · CPC title