Assay for pre-operative prediction of organ function recovery

US11512351B2 · US · B2

Patent metadata
FieldValue
Publication numberUS-11512351-B2
Application numberUS-202016888447-A
CountryUS
Kind codeB2
Filing dateMay 29, 2020
Priority dateJul 5, 2017
Publication dateNov 29, 2022
Grant dateNov 29, 2022

How to read this patent

A practical reading order for non-experts. Skip the full description unless you need deep technical detail.

  1. Title

    What the patent document calls the invention.

  2. Abstract

    A short plain-language summary of the technical disclosure.

  3. Assignees and inventors

    Who owns or filed the patent and who is credited as inventor.

  4. Key dates

    Filing, priority, publication, and grant dates set the timeline.

  5. First independent claim

    The legal scope of protection — read this for what is actually claimed.

  6. CPC / IPC classifications

    Technology tags used to group this patent with similar filings.

  7. Citations and related patents

    Prior art links and similar publications in this corpus.

Abstract

Official abstract text for this publication.

Gene expression is measured in a sample of peripheral blood mononuclear cells (PBMCs) obtained from a subject and used to predict organ function recovery. A Function Recovery Potential (FRP) score is assigned to a sample that reflects the measured expression level of the genes identified herein in a direction associated with recovery from organ failure. Treatment of the subject with optimal medical management (OMM) and/or palliative care (PC) is advised when the FRP score is lower than the reference value, and referring the subject for treatment with therapies including—but not limited to—mechanical circulatory support (MCS) surgery, heart transplant (HTx) surgery, or other intervention for advanced heart failure is advised when the FRP score is greater than the reference value. A method for developing an FRP scoring algorithm that predicts a subject's ability to recover from medical intervention for organ failure is also described.

First claim

Opening claim text (preview).

What is claimed is: 1. A method for treating an individual, comprising: (i) receiving a sample from the individual; (ii) determining a gene expression level in the sample for DNM1P46 and at least one gene comprising SAP25, NAPSA, RHBDD3, FRMD6, TIMP3, KIR2DL4, ANKRD22, BCORP1, BATF2, AGRN, or HEXA-AS1; (iii) determining, based on the gene expression level, a survival outcome probability for the individual wherein the determined survival outcome probability is the probability of post-operative survival following an interventional treatment or a surgical treatment; (iv) treating the individual with the interventional treatment or the surgical treatment when there is an indication to do so based on the determined survival outcome probability for the individual; and (v) treating the individual with a palliative treatment or a medical management when there is an indication to do so based on the determined survival outcome probability for the individual, wherein the interventional treatment, the surgical treatment, the palliative treatment, and the medical management treat organ failure in the individual. 2. The method of claim 1 , wherein the sample comprises blood, urine, sputum, hair, or skin. 3. The method of claim 1 , wherein the gene expression level is either an increase or a decrease in expression of the at least one gene relative to an expected expression level value. 4. The method of claim 1 , wherein the gene expression level is assigned a score, and wherein the survival outcome probability is based on the score. 5. The method of claim 4 , wherein the score comprises a Function Recovery Potential (FRP) score. 6. The method of claim 5 , wherein the score is determined based on a linear discriminant analysis of data comprising known gene expression levels and known FRP scores of a plurality of individuals. 7. The method of claim 6 , wherein the interventional treatment and surgical treatment are selected from mechanical circulatory support (MCS) surgery, heart transplant (HTx) surgery, coronary artery bypass graft (CABG) surgery, percutaneous coronary interventions (PCI), aortic valve replacement (AVR) surgery, mitral valve replacement (MVR) surgery, trans-catheter aortic valve replacement (TAVR), transcatheter mitral clip, ventricular tachycardia ablation, or stellate gangliectomy. 8. The method of claim 6 , wherein the gene expression level is a level determined by polymerase chain reaction (PCR), next generation sequencing (NGS), or other gene expression assay platform. 9. The method of claim 8 , wherein the PCR is performed using at least one primer selected from GAPDH-f: CCACTCCTCCACCTTTGAC (SEQ ID NO: 1); GAPDH-r: ACCCTGTTGCTGTAGCCA (SEQ ID NO: 2); KIR2DL4-f: ACCCACTGCCTGTTTCTGTC (SEQ ID NO: 3); KIR2DL4-r: ATCACAGCATGCAGGTGTCT (SEQ ID NO: 4); NAPSA-f: CAGGACACCTGGGTTCACAC (SEQ ID NO: 5); NAPSA-r: GGTTGGACTCGATGAAGAGG (SEQ ID NO: 6); BATF2-f: AAAGGCAGCTGAAGAAGCAG (SEQ ID NO: 7); BATF2-r: TCTTTTTCCAGAGACTCGTGC (SEQ ID NO: 8); ANKRD22-f: CTCAGCCAGGAAGGATTTTG (SEQ ID NO: 9); ANKRD22-r: TGATAGGCTGCTTGGCAGAT (SEQ ID NO: 10). 10. The method of claim 1 , wherein the organ failure comprises a liver disease. 11. The method of claim 10 , wherein the interventional treatment or the surgical treatment is liver surgery or a liver transplant. 12. The method of claim 1 , wherein the medical management comprises a guideline directed medical treatment. 13. The method of claim 1 , wherein the individual is suffering from kidney disease. 14. The method of claim 13 , wherein the interventional treatment or the surgical treatment is kidney surgery or a kidney transplant. 15. The method of claim 13 , wherein the medical management comprises guideline directed medical treatment or dialysis. 16. The method of claim 1 , wherein the individual is suffering from lung disease. 17. The method of claim 16 , wherein the interventional treatment or the surgical treatment is lung surgery or lung transplant. 18. The method of claim 16 , wherein the medical management comprises guideline directed medical treatment or ventilator therapy. 19. The method of claim 1 , wherein the individual is suffering from sepsis. 20. The method of claim 19 , wherein the medical management comprises guideline directed medical treatment or ventilator therapy.

Assignees

Inventors

Classifications

  • C12Q1/6883Primary

    for diseases caused by alterations of genetic material · CPC title

  • Expression markers · CPC title

  • Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism · CPC title

  • C12Q1/6876Primary

    Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes · CPC title

Patent family

Related publications grouped by family.

External sources

Frequently asked questions

Answers are generated from the same data shown on this page.

What does patent US11512351B2 cover?
Gene expression is measured in a sample of peripheral blood mononuclear cells (PBMCs) obtained from a subject and used to predict organ function recovery. A Function Recovery Potential (FRP) score is assigned to a sample that reflects the measured expression level of the genes identified herein in a direction associated with recovery from organ failure. Treatment of the subject with optimal med…
Who is the assignee on this patent?
Univ California
What technology area does this patent fall under?
Primary CPC classification C12Q1/6883. Mapped technology areas include Chemistry & Metallurgy.
When was this patent published?
Publication date Tue Nov 29 2022 00:00:00 GMT+0000 (Coordinated Universal Time) (B2). Legal status and post-grant events are not shown on this page.
What related patents are in patentsdb?
We list 2 related publications on this page (citations in our corpus or others sharing the same primary CPC).