Assay for pre-operative prediction of organ function recovery
US-10704093-B2 · Jul 7, 2020 · US
US11512351B2 · US · B2
| Field | Value |
|---|---|
| Publication number | US-11512351-B2 |
| Application number | US-202016888447-A |
| Country | US |
| Kind code | B2 |
| Filing date | May 29, 2020 |
| Priority date | Jul 5, 2017 |
| Publication date | Nov 29, 2022 |
| Grant date | Nov 29, 2022 |
A practical reading order for non-experts. Skip the full description unless you need deep technical detail.
What the patent document calls the invention.
A short plain-language summary of the technical disclosure.
Who owns or filed the patent and who is credited as inventor.
Filing, priority, publication, and grant dates set the timeline.
The legal scope of protection — read this for what is actually claimed.
Technology tags used to group this patent with similar filings.
Prior art links and similar publications in this corpus.
Official abstract text for this publication.
Gene expression is measured in a sample of peripheral blood mononuclear cells (PBMCs) obtained from a subject and used to predict organ function recovery. A Function Recovery Potential (FRP) score is assigned to a sample that reflects the measured expression level of the genes identified herein in a direction associated with recovery from organ failure. Treatment of the subject with optimal medical management (OMM) and/or palliative care (PC) is advised when the FRP score is lower than the reference value, and referring the subject for treatment with therapies including—but not limited to—mechanical circulatory support (MCS) surgery, heart transplant (HTx) surgery, or other intervention for advanced heart failure is advised when the FRP score is greater than the reference value. A method for developing an FRP scoring algorithm that predicts a subject's ability to recover from medical intervention for organ failure is also described.
Opening claim text (preview).
What is claimed is: 1. A method for treating an individual, comprising: (i) receiving a sample from the individual; (ii) determining a gene expression level in the sample for DNM1P46 and at least one gene comprising SAP25, NAPSA, RHBDD3, FRMD6, TIMP3, KIR2DL4, ANKRD22, BCORP1, BATF2, AGRN, or HEXA-AS1; (iii) determining, based on the gene expression level, a survival outcome probability for the individual wherein the determined survival outcome probability is the probability of post-operative survival following an interventional treatment or a surgical treatment; (iv) treating the individual with the interventional treatment or the surgical treatment when there is an indication to do so based on the determined survival outcome probability for the individual; and (v) treating the individual with a palliative treatment or a medical management when there is an indication to do so based on the determined survival outcome probability for the individual, wherein the interventional treatment, the surgical treatment, the palliative treatment, and the medical management treat organ failure in the individual. 2. The method of claim 1 , wherein the sample comprises blood, urine, sputum, hair, or skin. 3. The method of claim 1 , wherein the gene expression level is either an increase or a decrease in expression of the at least one gene relative to an expected expression level value. 4. The method of claim 1 , wherein the gene expression level is assigned a score, and wherein the survival outcome probability is based on the score. 5. The method of claim 4 , wherein the score comprises a Function Recovery Potential (FRP) score. 6. The method of claim 5 , wherein the score is determined based on a linear discriminant analysis of data comprising known gene expression levels and known FRP scores of a plurality of individuals. 7. The method of claim 6 , wherein the interventional treatment and surgical treatment are selected from mechanical circulatory support (MCS) surgery, heart transplant (HTx) surgery, coronary artery bypass graft (CABG) surgery, percutaneous coronary interventions (PCI), aortic valve replacement (AVR) surgery, mitral valve replacement (MVR) surgery, trans-catheter aortic valve replacement (TAVR), transcatheter mitral clip, ventricular tachycardia ablation, or stellate gangliectomy. 8. The method of claim 6 , wherein the gene expression level is a level determined by polymerase chain reaction (PCR), next generation sequencing (NGS), or other gene expression assay platform. 9. The method of claim 8 , wherein the PCR is performed using at least one primer selected from GAPDH-f: CCACTCCTCCACCTTTGAC (SEQ ID NO: 1); GAPDH-r: ACCCTGTTGCTGTAGCCA (SEQ ID NO: 2); KIR2DL4-f: ACCCACTGCCTGTTTCTGTC (SEQ ID NO: 3); KIR2DL4-r: ATCACAGCATGCAGGTGTCT (SEQ ID NO: 4); NAPSA-f: CAGGACACCTGGGTTCACAC (SEQ ID NO: 5); NAPSA-r: GGTTGGACTCGATGAAGAGG (SEQ ID NO: 6); BATF2-f: AAAGGCAGCTGAAGAAGCAG (SEQ ID NO: 7); BATF2-r: TCTTTTTCCAGAGACTCGTGC (SEQ ID NO: 8); ANKRD22-f: CTCAGCCAGGAAGGATTTTG (SEQ ID NO: 9); ANKRD22-r: TGATAGGCTGCTTGGCAGAT (SEQ ID NO: 10). 10. The method of claim 1 , wherein the organ failure comprises a liver disease. 11. The method of claim 10 , wherein the interventional treatment or the surgical treatment is liver surgery or a liver transplant. 12. The method of claim 1 , wherein the medical management comprises a guideline directed medical treatment. 13. The method of claim 1 , wherein the individual is suffering from kidney disease. 14. The method of claim 13 , wherein the interventional treatment or the surgical treatment is kidney surgery or a kidney transplant. 15. The method of claim 13 , wherein the medical management comprises guideline directed medical treatment or dialysis. 16. The method of claim 1 , wherein the individual is suffering from lung disease. 17. The method of claim 16 , wherein the interventional treatment or the surgical treatment is lung surgery or lung transplant. 18. The method of claim 16 , wherein the medical management comprises guideline directed medical treatment or ventilator therapy. 19. The method of claim 1 , wherein the individual is suffering from sepsis. 20. The method of claim 19 , wherein the medical management comprises guideline directed medical treatment or ventilator therapy.
for diseases caused by alterations of genetic material · CPC title
Expression markers · CPC title
Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism · CPC title
Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes · CPC title
Related publications grouped by family.
Answers are generated from the same data shown on this page.