RNA-guided human genome engineering

Patent metadata

Field	Value
Publication number	US-11512325-B2
Application number	US-202217672744-A
Country	US
Kind code	B2
Filing date	Feb 16, 2022
Priority date	Dec 17, 2012
Publication date	Nov 29, 2022
Grant date	Nov 29, 2022

Abstract

A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.

First claim

The invention claimed is:

1. An ex vivo eukaryotic stem cell comprising an RNA-guided system for use in the ex vivo eukaryotic stem cell comprising
(1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and
(2) a Cas protein of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system, wherein the Cas protein of a Type II CRISPR system is a Cas nickase of a Type II CRISPR system or a nuclease null Cas of a Type II CRISPR system,
wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript comprising a spacer sequence complementary to a target nucleic acid sequence within the ex vivo eukaryotic stem cell and a scaffold sequence, and wherein the scaffold sequence comprises GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:46).

2. The ex vivo eukaryotic stem cell of claim 1 wherein the Cas nickase is a Cas9 nickase and wherein the nuclease null Cas is a nuclease null Cas9.

3. The ex vivo eukaryotic stem cell of claim 1 wherein the ex vivo eukaryotic stem cell is a yeast cell, a plant cell, a mammalian cell or a human cell.

4. The ex vivo eukaryotic stem cell of claim 1 wherein the ex vivo eukaryotic stem cell is an ex vivo human induced pluripotent stem cell.

5. An ex vivo eukaryotic stem cell comprising an RNA-guided system for use in the ex vivo eukaryotic stem cell comprising
(1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and
(2) a Cas protein of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system, wherein the Cas protein of a Type II CRISPR system is a Cas nickase of a Type II CRISPR system or a nuclease null Cas of a Type II CRISPR system,
wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript comprising a spacer sequence complementary to a target nucleic acid sequence within the ex vivo eukaryotic stem cell and a scaffold sequence, and wherein the scaffold sequence comprises GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:45).

6. The ex vivo eukaryotic stem cell of claim 5 wherein the Cas nickase is a Cas9 nickase and wherein the nuclease null Cas is a nuclease null Cas9.

7. The ex vivo eukaryotic stem cell of claim 5 wherein the ex vivo eukaryotic stem cell is a yeast cell, a plant cell, a mammalian cell or a human cell.

8. The in vivo eukaryotic stem cell of claim 5 wherein the in vivo eukaryotic stem cell is a human induced pluripotent stem cell.

9. The ex vivo eukaryotic stem cell of claim 1 further comprising a regulatory element operable in a eukaryotic cell operably linked to the nucleotide sequence encoding the guide RNA sequence.

10. The ex vivo eukaryotic stem cell of claim 1 further comprising a human U6 polymerase III promoter operably linked to the nucleotide sequence encoding the guide RNA sequence.

11. The ex vivo eukaryotic stem cell of claim 1 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid.

12. The ex vivo eukaryotic stem cell of claim 1 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid including a nuclear localization signal.

13. The ex vivo eukaryotic stem cell of claim 1 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid including a C-terminal nuclear localization signal.

14. The ex vivo eukaryotic stem cell of claim 1 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid including a C-terminal SV40 nuclear localization signal.

15. The ex vivo eukaryotic stem cell of claim 1 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid comprising a regulatory element operable in a eukaryotic cell.

16. The ex vivo eukaryotic stem cell of claim 1 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid comprising a human U6 polymerase III promoter.

17. The ex vivo eukaryotic stem cell of claim 5 further comprising a regulatory element operable in a eukaryotic cell operably linked to the nucleotide sequence encoding the guide RNA sequence.

18. The ex vivo eukaryotic stem cell of claim 5 further comprising a human U6 polymerase III promoter operably linked to the nucleotide sequence encoding the guide RNA sequence.

19. The ex vivo eukaryotic stem cell of claim 5 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid.

20. The ex vivo eukaryotic stem cell of claim 5 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid including a nuclear localization signal.

21. The ex vivo eukaryotic stem cell of claim 5 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid including a C-terminal nuclear localization signal.

22. The ex vivo eukaryotic stem cell of claim 5 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid including a C-terminal SV40 nuclear localization signal.

23. The ex vivo eukaryotic stem cell of claim 5 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid comprising a regulatory element operable in a eukaryotic cell.

24. The ex vivo eukaryotic stem cell of claim 5 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid comprising a human U6 polymerase III promoter.

Assignees

• Harvard College

Inventors

• Church George M
• Mali Prashant G
• Yang Luhan

Classifications

• C12N2810/55

  from bacteria · CPC title

• C12N15/63

  Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression · CPC title

• C12N9/22 Primary

  Ribonucleases {[RNase]; Deoxyribonucleases [DNase]} · CPC title

• C12Y301/00

  Hydrolases acting on ester bonds (3.1) · CPC title

• C12N15/01

  Preparation of mutants without inserting foreign genetic material therein; Screening processes therefor · CPC title