Live attenuated cholera vaccine with probiotic properties

Patent metadata

Field	Value
Publication number	US-11484585-B2
Application number	US-201816629898-A
Country	US
Kind code	B2
Filing date	Jul 12, 2018
Priority date	Jul 12, 2017
Publication date	Nov 1, 2022
Grant date	Nov 1, 2022

Abstract

Provided herein are genetically engineered Vibrio cholerae bacterial strains, compositions including the bacterial strains, and methods of using the same for the prevention of Vibrio cholerae infection in a subject.

First claim

What is claimed is:

1. A genetically engineered Vibrio cholerae bacterium comprising:
(a) a deletion in a nucleic acid sequence encoding a cholera toxin subunit A wherein the deletion renders the bacterium incapable of expressing the cholera toxin subunit A;
(b) a heterologous nucleic acid sequence encoding a Cas9 nuclease molecule, wherein the Cas9 nuclease molecule is integrated into the genome of the bacterium;
(c) a heterologous nucleic acid sequence encoding a guide RNA (gRNA), wherein the gRNA comprises a targeting domain which is complementary with a target nucleic acid sequence of ctxA;
(d) a deletion in a nucleic acid sequence encoding a multifunctional-autoprocessing repeats-in-toxin (MARTX) toxin, wherein the deletion renders the bacterium incapable of producing the MARTX toxin;
(e) a deletion in a nucleic acid encoding a flagellin, wherein the deletion renders the bacterium incapable of producing the flagellin; and
(f) a deletion in a nucleic acid sequence encoding a RecA protein, wherein the deletion renders the bacterium incapable of producing RecA, wherein the bacterium is derived from a parental strain belonging to the El Tor biotype.

2. The genetically engineered Vibrio cholerae bacterium of claim 1 , wherein the deletion in the nucleic acid sequence encoding the cholera toxin subunit A is located in a ctxA gene that was integrated into the genome of the bacterium.

3. The genetically engineered Vibrio cholerae bacterium of claim 1 , wherein the bacterium comprises a deletion in a nucleic acid sequence of the core region of a CTXΦ genome that was integrated into the genome of the bacterium.

4. The genetically engineered Vibrio cholerae bacterium of claim 1 , wherein the bacterium comprises a deletion in a nucleic acid sequence of the RS2 region of a CTXΦ genome that was integrated into the genome of the bacterium.

5. The genetically engineered Vibrio cholerae bacterium of claim 1 , wherein the bacterium comprises a complete deletion of a CTXΦ genome that was integrated into the genome of the bacterium.

6. The genetically engineered Vibrio cholerae bacterium of claim 1 , wherein the gRNA comprises the nucleic acid sequence 5′-cctgatgaaataaagcagtcgttttagagctagaaat agcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc-3′ (SEQ ID NO: 3).

7. The genetically engineered Vibrio cholerae bacterium of claim 1 , wherein the nucleic acid sequence encoding the MARTX toxin is selected from the group consisting of rtxA, rtxB, rtxC, rtxD, and rtxE.

8. The genetically engineered Vibrio cholerae bacterium of claim 1 , wherein the bacterium further comprises a deletion in a nucleic acid sequence encoding a DNA-binding protein HU-beta.

9. The genetically engineered Vibrio cholerae bacterium of claim 8 , wherein the nucleic acid sequence encoding the DNA-binding protein HU-beta is a hupB gene.

10. The genetically engineered Vibrio cholerae bacterium of claim 1 , wherein the nucleic acid sequence encoding a flagellin is selected from the group consisting of flaA, flaB, flaC, flaD, and FlaE.

11. The genetically engineered Vibrio cholerae bacterium of claim 1 , wherein the bacterium comprises a heterologous nucleic acid, wherein the heterologous nucleic acid comprises a gene encoding cholera toxin subunit B that is operably-linked to a promoter.

12. The genetically engineered Vibrio cholerae bacterium of claim 11 , wherein the gene encoding cholera toxin subunit B is a ctxB gene.

13. The genetically engineered Vibrio cholerae bacterium of claim 11 , wherein the promoter is a P htpg promoter.

14. The genetically engineered Vibrio cholerae bacterium of claim 1 , wherein the bacterium is derived from a Haiti parental strain, and/or is Inaba serotype, Ogawa serotype, or Hikojima serotype.

15. A pharmaceutical composition comprising the genetically engineered Vibrio cholerae bacterium of claim 1 and a pharmaceutically acceptable excipient.

16. The genetically engineered Vibrio cholerae bacterium of claim 1 , wherein the bacterium comprises deletion of a dfrA gene, wherein the dfrA gene encodes a product that confers resistance to trimethoprim, and wherein the deletion prevents dispersal of the dfrA gene to other bacteria.

17. The genetically engineered Vibrio cholerae bacterium of claim 1 , wherein the bacterium comprises deletion of a sul2 gene, wherein the sul2 gene encodes a product that confers resistance to sulfamethoxazole, and wherein the deletion prevents dispersal of the sul2 gene to other bacteria.

18. The genetically engineered Vibrio cholerae bacterium of claim 1 , wherein the bacterium comprises deletion of a strAB gene, wherein the strAB gene encodes a product that confers resistance to streptomycin, and wherein the deletion prevents dispersal of the strAB gene to other bacteria.

19. The genetically engineered Vibrio cholerae bacterium of claim 1 , wherein the bacterium comprises deletion of a floR gene, wherein the floR gene encodes a product that confers resistance to chloramphenicol, and wherein the deletion prevents dispersal of the floR gene to other bacteria.

20. The genetically engineered Vibrio cholerae bacterium of claim 1 , wherein the deletion in the nucleic acid sequence encoding the cholera toxin subunit A is in a nucleic acid sequence of the core region of a CTXΦ genome that was integrated into the genome of the bacterium, and wherein the deletion protects against toxigenic reversion by preventing chromosomal integration of CTXΦ.

Assignees

• Brigham & Womens Hospital Inc

Inventors

• Waldor Matthew K
• Hubbard Troy
• Billings Gabriel

Classifications

• Y02A50/30

  Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change · CPC title

• A61P1/12

  Antidiarrhoeals · CPC title

• C12N15/113

  Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)} · CPC title

• C12N9/22

  Ribonucleases {[RNase]; Deoxyribonucleases [DNase]} · CPC title

• C12N1/205

  Bacterial isolates · CPC title