RNA-guided human genome engineering

Patent metadata

Field	Value
Publication number	US-11359211-B2
Application number	US-201916397423-A
Country	US
Kind code	B2
Filing date	Apr 29, 2019
Priority date	Dec 17, 2012
Publication date	Jun 14, 2022
Grant date	Jun 14, 2022

Abstract

A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.

First claim

The invention claimed is:

1. An RNA-guided genome editing system for use in a eukaryotic cell comprising
(1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and
(2) a Cas enzyme of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system,
wherein the guide RNA sequence comprises a spacer sequence complementary to a target nucleic acid sequence within the eukaryotic cell and a scaffold sequence, and wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript of between 100 and 250 nucleotides,
wherein the guide RNA has a secondary structure comprising a first hairpin connected to the spacer sequence and a second 3′ hairpin.

2. An ex vivo eukaryotic cell containing the RNA-guided genome editing system of claim 1 .

3. The eukaryotic cell of claim 2 wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell or a human cell.

4. The eukaryotic cell of claim 2 wherein the eukaryotic cell is a stem cell.

5. The eukaryotic cell of claim 2 wherein the eukaryotic cell is a human induced pluripotent stem cell.

6. The RNA-guided genome editing system of claim 1 comprising (1) the first nucleic acid sequence encoding the guide RNA sequence and further comprising a regulatory element operable in a eukaryotic cell operably linked to the first nucleic acid sequence encoding the guide RNA sequence.

7. The RNA-guided genome editing system of claim 1 comprising (1) the first nucleic acid sequence encoding the guide RNA sequence and further comprising a human U6 polymerase III promoter operably linked to the first nucleic acid sequence encoding the guide RNA sequence.

8. The RNA-guided genome editing system of claim 1 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid.

9. The RNA-guided genome editing system of claim 1 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid and encodes a nuclear localization signal.

10. The RNA-guided genome editing system of claim 1 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid and encodes a C-terminal nuclear localization signal.

11. The RNA-guided genome editing system of claim 1 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid and encodes a C-terminal SV40 nuclear localization signal.

12. The RNA-guided genome editing system of claim 1 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid comprising a regulatory element operable in a eukaryotic cell.

13. The RNA-guided genome editing system of claim 1 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid comprising a human U6 polymerase III promoter.

14. The RNA-guided genome editing system of claim 1 wherein the Cas enzyme of a Type II CRISPR system is Cas9.

15. The RNA-guided genome editing system of claim 1 wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell or a human cell.

16. The RNA-guided genome editing system of claim 1 wherein the eukaryotic cell is a stem cell.

17. The RNA-guided genome editing system of claim 1 wherein the eukaryotic cell is a human induced pluripotent stem cell.

18. An RNA-guided genome editing system for use in a eukaryotic cell comprising
(1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and
(2) a Cas enzyme of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system,
wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript comprising a spacer sequence complementary to a target nucleic acid sequence within the eukaryotic cell and a scaffold sequence, and wherein the scaffold sequence comprises GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:46).

19. The RNA-guided genome editing system of claim 18 comprising (1) the first nucleic acid sequence encoding the guide RNA sequence and further comprising a regulatory element operable in a eukaryotic cell operably linked to the first nucleic acid sequence encoding the guide RNA sequence.

20. The RNA-guided genome editing system of claim 18 comprising (1) the first nucleic acid sequence encoding the guide RNA sequence and further comprising a human U6 polymerase III promoter operably linked to the first nucleic acid sequence encoding the guide RNA sequence.

21. The RNA-guided genome editing system of claim 18 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid.

22. The RNA-guided genome editing system of claim 18 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid and encodes a nuclear localization signal.

23. The RNA-guided genome editing system of claim 18 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid and encodes a C-terminal nuclear localization signal.

24. The RNA-guided genome editing system of claim 18 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid and encodes a C-terminal SV40 nuclear localization signal.

25. The RNA-guided genome editing system of claim 18 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid comprising a regulatory element operable in a eukaryotic cell.

26. The RNA-guided genome editing system of claim 18 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid comprising a human U6 polymerase III promoter.

Assignees

• Harvard College

Inventors

• Church George M
• Mali Prashant G
• Yang Luhan

Classifications

• C12N9/22 Primary

  Ribonucleases {[RNase]; Deoxyribonucleases [DNase]} · CPC title

• C12N2310/20

  involving clustered regularly interspaced short palindromic repeats [CRISPR] · CPC title

• C12N15/907

  in mammalian cells · CPC title

• C12N15/79 Primary

  Vectors or expression systems specially adapted for eukaryotic hosts · CPC title

• C12N15/113

  Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)} · CPC title