Delivery and formulation of engineered nucleic acids
US-2024252645-A1 · Aug 1, 2024 · US
US11286504B2 · US · B2
| Field | Value |
|---|---|
| Publication number | US-11286504-B2 |
| Application number | US-201916296260-A |
| Country | US |
| Kind code | B2 |
| Filing date | Mar 8, 2019 |
| Priority date | Sep 9, 2016 |
| Publication date | Mar 29, 2022 |
| Grant date | Mar 29, 2022 |
A practical reading order for non-experts. Skip the full description unless you need deep technical detail.
What the patent document calls the invention.
A short plain-language summary of the technical disclosure.
Who owns or filed the patent and who is credited as inventor.
Filing, priority, publication, and grant dates set the timeline.
The legal scope of protection — read this for what is actually claimed.
Technology tags used to group this patent with similar filings.
Prior art links and similar publications in this corpus.
Official abstract text for this publication.
The present invention discloses A METHOD TO PRODUCE PROTEIN IN PENICILLIUM AMAGASAKIENSE'S SLEEPING SPORES BY TRANSFORMATION OF SSRNA. The method includes three steps of culture of Penicillium amagasakiense and collection of spores, pretreatment of Penicillium anagasakiense spores, and electroporation of Penicillium anagasakiense spores by using HDEN method. In the present invention, non-germinated spores are used as a starting material for introduction of exogenous molecules. The exogenous protein coding single stranded RNA is introduced into the resting spores of Penicillium amagasakiense by employing the HDEN electrotransformation technique to express protein. The method of this invention is simple and fast, the effect is excellent, and the transformation rate reaches more than 90%.
Opening claim text (preview).
I claim: 1. A method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein, characterized in that, the method comprising steps of: 1) culture of Penicillium amagasakiense and collection of spores Penicillium amagasakiense is inoculated onto a surface of a solid agar medium, and cultured until Penicillium amagasakiense spores are overgrown on the surface of the medium, the Penicillium amagasakiense spores are washed off from the surface of the medium, suspension of the spores is aspirated off and filtered to remove mycelia, and filtrate containing the spores is collected, and centrifuged to collect the pelleted resting spores; 2) pretreatment of Penicillium amagasakiense spores the spores are re-suspended in an electroporation buffer, and centrifuged to collect the spore pellets, the re-suspension and centrifugation steps are repeated 3-4 times, and the last collected spore pellets are re-suspended in the electroporation buffer, to obtain an Penicillium amagasakiense spore suspension with a spore concentration of 10 4 -10 11 spores/ml, in which the electroporation buffer consists of 4-hydroxyethyl piperazineethanesulfonic acid having a final concentration of 0.01-100 mmol/L and mannitol having a final concentration of 0.5-5000 mmol/L, and the pH of the electroporation buffer is 3.0-9.5; and 3) Electroporation of Penicillium amagasakiense spores by using high-density distributed electrode network (HDEN) method the Penicillium amagasakiense spore suspension prepared in the above steps and a RNA to be transformed are added to wells of a cell culture plate and mixed uniformly, to obtain a mixture of the spores and the RNA, the cell culture plate is placed on an ice bath for 10-15 min, subsequently electroporation is carried out by using the HDEN method using an Etta Biotech X-Porator H1 electroporator, by inserting an electroporator head fitted with a matrix electrode into the mixture of the spores and the RNA, and energizing, to generate an electric field inside the mixture of the spores and the RNA, the cell culture plate is placed on the ice bath again for 10-15 min after electroporation, and subsequently the mixture of the spores and the RNA is aspirated off, to obtain resting spores of Penicillium amagasakiense with introduction of exogenous RNA, in which ratio of the Penicillium amagasakiense suspension to the RNA to be transformed is 0.6-60000 μl of Penicillium amagasakiense spore suspension to 0.1-10000 μg of RNA to be transformed; and parameters for the electroporation comprise: a voltage of 1-6000 V, pulse duration of 2-2000000 ms, and repeat for 1-100 times at an interval of 5-50000 ms. 2. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 1 , characterized in that, the medium in the step 1) is PDA medium, YPD medium, or Czapek-Dox medium. 3. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 1 , characterized in that, in the step 1), Penicillium amagasakiense is cultured at a temperature of 16-40° C. with 15-85% humidity for 3-15 days. 4. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 1 , characterized in that, in the step 2), the Penicillium amagasakiense spore suspension is observed under a microscope before electroporation, to confirm that the spore suspension is free of contamination with mycelia and the spores are non-germinated, and subsequently electroporation is carried out. 5. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 1 , characterized in that, in the step 3), the RNA to be transformed is an exogenous protein encoding single-stranded RNA and can produce protein in host cells. 6. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 5 , characterized in that, the RNA is encoded RNA of the green fluorescent protein, or encoded RNA of the red fluorescent protein, or encoded RNA of the yellow fluorescent protein. 7. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 6 , characterized in that, the following PCR primers are used to amplify the green fluorescent protein gene or the yellow fluorescent protein gene: F: (SEQ ID NO. 1) 5′ AGATGACGTCGCTAGCATGGTGAGCAAGGGC 3′, R: (SEQ ID NO. 2) 5′ ACGCGTCGACTTACTTGTACAGCTCGT3′, Among them, the GCTAGC sequence in the primer F near the 5′ end is used to promote binding of eukaryotic initiation factor and RNA which in vitro transcribed from DNA, this sequence adjacent to the target gene's start codon ATG. 8. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 6 , characterized in that, the following PCR primers are used to amplify the red fluorescent protein gene: RFP-F: (SEQ ID NO. 3) 5′ CGGAATTCGCCACCATGGCCTCCTCCGAGGACGT 3′, RFP-R: (SEQ ID NO. 4) 5′ TCGAGCTCGTTAGGCGCCGGTGGAGTGG 3′, The GCCACC sequence in the primer RFP-F near the 5′ end is used to promote binding of eukaryotic initiation factor and RNA which in vitro transcribed from DNA, this sequence adjacent to the target gene's start codon ATG. 9. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 1 , characterized in that, in the step 3), in which ratio of the Penicillium amagasakiense suspension to the RNA to be transformed is 60 μl of Penicillium amagasakiense spore suspension to 10 μg of RNA to be transformed. 10. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 1 , characterized in that, in the step 3), the parameters for the electroporation comprise: a voltage of 450 V, pulse duration of 2500 ms, and repeat for 3 times at an interval of 400 ms.
Cells modified by introduction of foreign genetic material · CPC title
Fungi isolates · CPC title
Penicillium · CPC title
Fusion polypeptide · CPC title
Fungi (culture of mushrooms A01G18/00; as new plants A01H15/00); Culture media therefor · CPC title
Related publications grouped by family.
Answers are generated from the same data shown on this page.