Olmalinc as a diagnostic and therapeutic target for NAFLD, NASH, metabolic syndrome, and hepatic fibrosis

Patent metadata

Field	Value
Publication number	US-11274303-B2
Application number	US-201816753962-A
Country	US
Kind code	B2
Filing date	Oct 5, 2018
Priority date	Oct 6, 2017
Publication date	Mar 15, 2022
Grant date	Mar 15, 2022

Abstract

An oligonucleotide that inhibits expression of an OLMALINC nucleic acid molecule, such as a small inhibitory RNA (siRNA) molecule, can be used for inhibiting the expression of OLMALINC in a subject. Methods of assaying for OLMALINC in a tissue sample can be used for detecting a disorder associated with obesity and/or type 2 diabetes in a tissue sample obtained from a subject. A method of ameliorating symptoms associated with obesity and/or type 2 diabetes comprises administering to a subject in need thereof an effective amount of an oligonucleotide of the invention or an antibody or equivalent thereof that specifically binds to and inactivates an OLMALINC nucleic acid molecule. Representative examples of a disorder associated with obesity and/or type 2 diabetes include, but are not limited to, a disorder of appetite, glycemia, body weight, liver steatosis, NASH, NAFLD, or a lipid disorder.

First claim

What is claimed is:

1. An oligonucleotide that inhibits expression of an OLMALINC nucleic acid molecule, wherein the oligonucleotide is selected from SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.

2. The oligonucleotide of claim 1 , wherein the OLMALINC nucleic acid molecule is SEQ ID NO: 1.

3. The oligonucleotide of claim 1 , which is CTCCGTGAGGAGATCCACCTA (SEQ ID NO: 4).

4. A method of inhibiting the expression of OLMALINC in a subject, the method comprising administering to the subject an effective amount of an oligonucleotide of claim 1 or equivalent thereof that specifically binds to and inactivates an OLMALINC nucleic acid molecule.

5. A method of ameliorating symptoms associated with obesity and/or type 2 diabetes, the method comprising administering to a subject in need thereof an effective amount of an oligonucleotide of claim 1 or equivalent thereof that specifically binds to and inactivates an OLMALINC nucleic acid molecule, wherein the equivalent thereof is selected from TACACCTATCCCAAACCTATA (SEQ ID NO: 10); GAGATTCTTTGTGGGCTCTTA (SEQ ID NO: 11); CCCACGCTAACTGATACCATA (SEQ ID NO: 12); AAGGAACAUCUUGCCAAUUUCAAAT (SEQ ID NO: 13); and UGCCCCACGCUAACUGAUACCAUAT (SEQ ID NO: 14).

6. A pharmaceutical composition comprising an oligonucleotide of claim 1 , formulated for delivery to a patient in need of ameliorating appetite, glycemia, body weight, obesity, liver steatosis, NASH, NAFLD, lipid disorder, and/or other symptoms associated with obesity disorders and type 2 diabetes.

7. The pharmaceutical composition of claim 6 , further comprising a pharmaceutically acceptable carrier.

8. The method of claim 5 , wherein the disorder associated with obesity and/or type 2 diabetes is a disorder of appetite, glycemia, body weight, liver steatosis, NASH, NAFLD, or a lipid disorder.

9. The method of claim 5 , wherein the method comprises administering an oligonucleotide selected from SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4, to the subject.

10. The method of claim 9 , wherein the oligonucleotide is SEQ ID NO: 4.

Assignees

• Univ California
• Us Gov Represented By The Department Of Veterans Affairs
• Univ Of Eastern Finland

Inventors

• Pajukanta Paivi E
• Pisegna Joseph R
• Benhammou Jihane N
• Ko Arthur
• Pihlajamäki Jussi

Classifications

• C12N15/113 Primary

  Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)} · CPC title

• C12N2310/14

  interfering nucleic acids [NA] · CPC title

• C12N2310/113

  targeting other non-coding nucleic acids, e.g. antagomirs · CPC title

• C12N2320/30

  Special therapeutic applications · CPC title

• A61K45/06

  Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca · CPC title