Nucleic acid-controlled catalytic rnas for trigger-responsive regulation
US-2024425855-A1 · Dec 26, 2024 · US
MicroRNAs for cardiac regeneration through induction of cardiac myocyte proliferation
US11236332B2 · US · B2
| Field | Value |
|---|---|
| Publication number | US-11236332-B2 |
| Application number | US-201916400333-A |
| Country | US |
| Kind code | B2 |
| Filing date | May 1, 2019 |
| Priority date | Dec 23, 2011 |
| Publication date | Feb 1, 2022 |
| Grant date | Feb 1, 2022 |
How to read this patent
A practical reading order for non-experts. Skip the full description unless you need deep technical detail.
- Title
What the patent document calls the invention.
- Abstract
A short plain-language summary of the technical disclosure.
- Assignees and inventors
Who owns or filed the patent and who is credited as inventor.
- Key dates
Filing, priority, publication, and grant dates set the timeline.
- First independent claim
The legal scope of protection — read this for what is actually claimed.
- CPC / IPC classifications
Technology tags used to group this patent with similar filings.
- Citations and related patents
Prior art links and similar publications in this corpus.
Abstract
Official abstract text for this publication.
The present invention discloses a set of human microRNAs, or a primary transcript for such microRNAs, or a precursor of such microRNAs, or a mimic of such microRNAs or a combination thereof, and their use as medicaments for inducing proliferation of cardiomyocytes for the prevention and treatment of heart diseases associated with a loss of cardiomyocytes. The invention also relates to a method for screening microRNAs and biological and therapeutically active compounds for their ability to increase proliferation of cardiomyocytes.
First claim
Opening claim text (preview).
The invention claimed is: 1. A human cardiomyocyte comprising a vector, said vector comprising at least a microRNA and/or a DNA coding for at least said microRNA and/or a DNA coding for at least a primary transcript or a precursor for said microRNA, or a combination thereof, wherein said microRNA, or combination of microRNAs, is selected from the group consisting of: (SEQ ID NO: 29) UAAUUUUAUGUAUAAGCUAGU, (SEQ ID NO: 14) ACAGUAGUCUGCACAUUGGUUA, and (SEQ ID NO: 1) ACUGCCCUAAGUGCUCCUUCUGG. 2. The cardiomyocyte according to claim 1 , wherein the vector is an adeno-associated vector (AAV) of any capsid serotype.
Assignees
Inventors
Classifications
Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy · CPC title
Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00 · CPC title
for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis · CPC title
MicroRNAs, miRNAs · CPC title
from embryonic cells · CPC title
Patent family
Related publications grouped by family.
External sources
Frequently asked questions
Answers are generated from the same data shown on this page.
- What does patent US11236332B2 cover?
- The present invention discloses a set of human microRNAs, or a primary transcript for such microRNAs, or a precursor of such microRNAs, or a mimic of such microRNAs or a combination thereof, and their use as medicaments for inducing proliferation of cardiomyocytes for the prevention and treatment of heart diseases associated with a loss of cardiomyocytes. The invention also relates to a method …
- Who is the assignee on this patent?
- Int Centre For Genetic Engineering And Biotechnology Icgeb, King S College London
- What technology area does this patent fall under?
- Primary CPC classification C12N15/113. Mapped technology areas include Chemistry & Metallurgy.
- When was this patent published?
- Publication date Tue Feb 01 2022 00:00:00 GMT+0000 (Coordinated Universal Time) (B2). Legal status and post-grant events are not shown on this page.
- What related patents are in patentsdb?
- We list 8 related publications on this page (citations in our corpus or others sharing the same primary CPC).