Compositions and methods for inhibiting expression of the ALAS1 gene

Patent metadata

Field	Value
Publication number	US-11028392-B2
Application number	US-201816137046-A
Country	US
Kind code	B2
Filing date	Sep 20, 2018
Priority date	Oct 4, 2013
Publication date	Jun 8, 2021
Grant date	Jun 8, 2021

Abstract

The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the ALAS1 gene, and methods of using such dsRNA compositions to alter (e.g., inhibit) expression of ALAS1.

First claim

We claim:

1. A double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS1 RNA transcript, which antisense strand comprises at least 22 contiguous nucleotides from the antisense sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154).

2. The dsRNA of claim 1 , wherein said dsRNA comprises at least one modified nucleotide.

3. The dsRNA of claim 1 , wherein the dsRNA comprises a duplex region which is 21-23 nucleotide pairs in length.

4. The dsRNA of claim 1 , wherein at least one strand comprises a 3′ overhang of at least 2 nucleotides.

5. The dsRNA of claim 1 , wherein each strand is no more than 26 nucleotides in length.

6. The dsRNA of claim 2 , wherein at least one modified nucleotide is chosen from a 2′-O-methyl, a 2′-fluoro modified nucleotide, or both.

7. The dsRNA of claim 6 , further comprising a ligand.

8. The dsRNA of claim 7 , wherein the ligand comprises a carbohydrate.

9. The dsRNA of claim 8 , wherein the ligand is

10. The dsRNA of claim 1 , wherein the sense strand comprises or consists of the sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155).

11. The dsRNA of claim 1 , wherein:
(i) the antisense strand comprises the sequence of SEQ ID NO: 4157, and/or the sense strand comprises the sequence of SEQ ID NO: 4156, or
(ii) the antisense strand consists of the sequence of SEQ ID NO: 4157, and/or the sense strand consists of the sequence of SEQ ID NO: 4156.

12. The dsRNA of claim 1 , wherein:
(i) the antisense strand comprises the sequence of SEQ ID NO: 4165, and/or the sense strand comprises the sequence of SEQ ID NO: 4164, or
(ii) the antisense strand consists of the sequence of SEQ ID NO: 4165, and/or the sense strand consists of the sequence of SEQ ID NO: 4164.

13. A vector encoding at least one strand of a dsRNA of claim 1 .

14. An isolated cell comprising the dsRNA of claim 1 .

15. A pharmaceutical composition for inhibiting expression of an ALAS1 gene, the composition comprising the dsRNA of claim 1 .

16. A method of inhibiting ALAS1 expression in a liver cell, the method comprising:
(a) introducing into the cell the dsRNA of claim 1 , and
(b) maintaining the cell of step (a) for a time sufficient to obtain degradation of the mRNA transcript of an ALAS1 gene, thereby inhibiting expression of the ALAS1 gene in the cell.

17. A method for decreasing a level of a porphyrin or a porphyrin precursor in a cell, comprising contacting the cell with the dsRNA of claim 1 , in an amount effective to decrease the level of the porphyrin or the porphyrin precursor in the cell.

18. A method of treating a porphyria, the method comprising administering to a subject in need of such treatment a therapeutically effective amount of the dsRNA of claim 1 , thereby treating the porphyria.

19. The method of claim 18 , wherein the porphyria is acute intermittent porphyria or ALA-dehydratase deficiency porphyria.

20. The method of claim 18 , wherein (i) the dsRNA is administered after an acute attack of porphyria, (ii) the dsRNA is administered during an acute attack of porphyria, or (iii) the dsRNA is administered prophylactically to prevent an acute attack of porphyria.

21. The method of claim 18 , wherein the dsRNA is administered at a dose of 0.05 mg/kg to 50 mg/kg, 0.01 mg/kg to 5 mg/kg, or 1 mg/kg to 2.5 mg/kg bodyweight of the subject, or at a dose of 1 mg/kg, 2.5 mg/kg, or 5 mg/kg bodyweight of the subject.

22. The method of claim 18 , wherein the method
(i) decreases a level of a porphyrin or a porphyrin precursor in the subject, wherein the porphyrin precursor is δ-aminolevulinic acid (ALA) or porphopilinogen (PBG), wherein the level is decreased by at least 40%; and/or
(ii) inhibits ALAS1 expression by at least 40% in the subject.

23. The method of claim 18 , wherein said method (i) ameliorates a symptom associated with an ALAS1 related disorder, (ii) decreases frequency of acute attacks of symptoms associated with a porphyria in the subject, and/or (iii) decreases incidence of acute attacks of symptoms associated with a porphyria in the subject when the subject is exposed to a precipitating factor.

24. The method of claim 18 , wherein the dsRNA weekly, biweekly, or monthly.

25. The method of claim 18 , wherein the subject has an elevated level of ALA and/or PBG.

26. The method of claim 18 , wherein the method decreases or prevents pain, neuropathy, and/or nerve damage.

27. The pharmaceutical composition of claim 15 , comprising about 200 mg/mL of the dsRNA.

28. The pharmaceutical composition of claim 15 , wherein the pharmaceutical composition has a pH of 6.0-7.5.

29. The dsRNA of claim 1 , wherein the ALAS1 RNA transcript comprises the sequence of SEQ ID NO: 1.

30. The dsRNA of claim 1 , wherein the dsRNA has one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, or all of the following:
(i) is chemically synthesized;
(ii) all the nucleotides in the dsRNA are modified;
(iii) all nucleotides are connected through 3′-5′ phosphodiester linkages;
(iv) the sense strand comprises or consists of 21 nucleotides;
(v) the antisense sense strand comprises or consists of 23 nucleotides;
(vi) has a blunt-end at the 3′-end of sense strand;
(vii) has a 3′-overhang;
(viii) is covalently attached to a ligand containing three N-acetylgalactosamine (GalNAc) moieties;
(ix) the 3′-end of the sense strand is conjugated to the triantennary GalNAc moiety;
(x) has an antisense strand that comprises one or more phosphorothioate linkages;
(xi) has a sense strand that comprises one or more phosphorothioate linkages;
(xii) 21 nucleotides of the sense strand hybridize to the complementary 21 nucleotides of the antisense strand;
(xiii) forms 21 nucleotide base pairs and a two-base overhang at the 3′-end of the antisense strand;
(xiv) comprises, or consists of, a sense strand having the sequence of SEQ ID NO: 4160 or 4162 and an antisense strand having the sequence of SEQ ID NO: 4161 or 4163;
(xv) has a sense strand with 10, 12, 14, 16, 18, 19, 20 or all of the modifications of the sequence of SEQ ID NO: 4160; or
(xvi) has an antisense strand with 10, 12, 14, 16, 18, 19, 20 or all of the modifications of the sequence of SEQ ID NO: 4161.

31. The dsRNA of claim 6 , wherein the dsRNA comprises one or more phosphorothioate linkages.

32. The dsRNA of claim 7 , wherein the ligand is conjugated to the 3′ end of the sense strand of the dsRNA.

33. The dsRNA of claim 8 , wherein the ligand is a GalNAc ligand.

34. The method of claim 16 , wherein the expression of ALAS1 is inhibited by at least 80% at 10 nM of the dsRNA as measured by branched DNA (bDNA) assay at 24 hours post-transfection.

35. The method of claim 18 , wherein the subject is at risk for developing, or is diagnosed with, a porphyria.

36. The method of claim 25 , wherein the subject suffers from chronic pain.

37. The method of claim 25 , wherein the method decreases or

Assignees

• Alnylam Pharmaceuticals Inc
• Icahn School Med Mount Sinai

Inventors

• Bettencourt Brian
• Fitzgerald Kevin
• Querbes William
• Desnick Robert J
• Yasuda Makiko

Classifications

• C12Q2600/118

  Prognosis of disease development · CPC title

• A61K31/7105

  Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links · CPC title

• C12Q1/6883

  for diseases caused by alterations of genetic material · CPC title

• A61K31/713

  Double-stranded nucleic acids or oligonucleotides · CPC title

• C12N2310/341

  Gapmers, i.e. of the type ===---=== · CPC title